ID: 1118391765

View in Genome Browser
Species Human (GRCh38)
Location 14:65301908-65301930
Sequence CCAAATATGCAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118391761_1118391765 10 Left 1118391761 14:65301875-65301897 CCAGGATTCTCAAATTTAGTCTC No data
Right 1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG No data
1118391758_1118391765 29 Left 1118391758 14:65301856-65301878 CCAACGTAATCCAGACTGACCAG No data
Right 1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG No data
1118391760_1118391765 19 Left 1118391760 14:65301866-65301888 CCAGACTGACCAGGATTCTCAAA No data
Right 1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118391765 Original CRISPR CCAAATATGCAAATGGACAA TGG Intergenic
No off target data available for this crispr