ID: 1118392457

View in Genome Browser
Species Human (GRCh38)
Location 14:65306801-65306823
Sequence GCTGATGGTTAGAAAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118392455_1118392457 18 Left 1118392455 14:65306760-65306782 CCTCGAGGTAATGAGTTCTCACT No data
Right 1118392457 14:65306801-65306823 GCTGATGGTTAGAAAGAGCCTGG No data
1118392454_1118392457 21 Left 1118392454 14:65306757-65306779 CCTCCTCGAGGTAATGAGTTCTC No data
Right 1118392457 14:65306801-65306823 GCTGATGGTTAGAAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118392457 Original CRISPR GCTGATGGTTAGAAAGAGCC TGG Intergenic
No off target data available for this crispr