ID: 1118398584

View in Genome Browser
Species Human (GRCh38)
Location 14:65358566-65358588
Sequence ACTTCGGTCTACAGAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118398576_1118398584 28 Left 1118398576 14:65358515-65358537 CCCAGGCTGGAGTGCAGTAGTAT 0: 128
1: 4867
2: 66211
3: 210428
4: 256754
Right 1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG No data
1118398577_1118398584 27 Left 1118398577 14:65358516-65358538 CCAGGCTGGAGTGCAGTAGTATG 0: 113
1: 4563
2: 61482
3: 155780
4: 237018
Right 1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG No data
1118398579_1118398584 3 Left 1118398579 14:65358540-65358562 CCTCCTCAGGCTCAAGCGATCCT No data
Right 1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG No data
1118398580_1118398584 0 Left 1118398580 14:65358543-65358565 CCTCAGGCTCAAGCGATCCTCCT No data
Right 1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118398584 Original CRISPR ACTTCGGTCTACAGAGTAAC TGG Intergenic
No off target data available for this crispr