ID: 1118404809

View in Genome Browser
Species Human (GRCh38)
Location 14:65412745-65412767
Sequence GGGGAAGCCTCGGCCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118404809_1118404815 6 Left 1118404809 14:65412745-65412767 CCGGCGCTGGCCGAGGCTTCCCC 0: 1
1: 1
2: 2
3: 21
4: 189
Right 1118404815 14:65412774-65412796 GCTCGTTGTCAGAGCCGCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 58
1118404809_1118404818 28 Left 1118404809 14:65412745-65412767 CCGGCGCTGGCCGAGGCTTCCCC 0: 1
1: 1
2: 2
3: 21
4: 189
Right 1118404818 14:65412796-65412818 GCGCGTGCGCGCGTTATCTCCGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118404809 Original CRISPR GGGGAAGCCTCGGCCAGCGC CGG (reversed) Intronic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
900338511 1:2176676-2176698 CAGGCAGCCTCGGCCAGCGTGGG + Intronic
900438698 1:2643030-2643052 AGTGAAGCCTCGGCCCGCGCAGG + Intronic
901608048 1:10474921-10474943 GGAGAAACCTCGCCCAGCGGCGG + Exonic
901800958 1:11707765-11707787 GGGGAAGCCTGGGCCAGCAGGGG - Intronic
901832039 1:11898639-11898661 GGAGAAGCCGGGGCCAGCACAGG - Intergenic
901882438 1:12202141-12202163 GGGGAGGCCCGGGCCAGCACCGG + Exonic
902360874 1:15942003-15942025 GGGGAGGTCTCTGCCAGTGCGGG + Exonic
902963924 1:19984554-19984576 GGGGGAGGCTCGGGCCGCGCAGG + Intergenic
903588813 1:24438593-24438615 GGGGAAGCCTCGGCCAGCTCTGG + Intronic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
903888881 1:26556789-26556811 AGGGGAGCCTCTGCCAGCGAGGG + Intronic
904286535 1:29456274-29456296 GGGGCAGCCTGGACCAGGGCAGG + Intergenic
905058623 1:35120794-35120816 GGAGCAGCCGCGGCCAGAGCCGG + Intergenic
905703802 1:40039842-40039864 GAGGCAGCCTCGCCCAGGGCTGG - Intergenic
905862589 1:41361343-41361365 GCGGAATCCTCAGCCAGCCCAGG - Intergenic
907298677 1:53471591-53471613 GGTGAAGCCTAGGCCACAGCAGG - Intergenic
918793215 1:188857953-188857975 TGGGGAGGCTCGGGCAGCGCAGG - Intergenic
920731340 1:208488538-208488560 GGGGAAGGCTCAGGCACCGCGGG + Intergenic
923055879 1:230425870-230425892 CGGGCAGCCTCGAGCAGCGCCGG + Intergenic
1066370657 10:34815587-34815609 GGGGGCGCCTGGGCCAGGGCTGG - Intergenic
1067836204 10:49643447-49643469 GGGGAGGCCTTGGCCAGGTCTGG - Intronic
1067852369 10:49762042-49762064 GGGGAGGCCACGGCCAGCCAAGG + Intronic
1070776665 10:79113756-79113778 GGGGCAGCCTTGGCCAGAGTAGG - Intronic
1073060499 10:100730739-100730761 GGGAGGGCCTCGGCCAGCCCCGG - Intergenic
1076550301 10:131273601-131273623 GAGGGAGCCTCGGTCAGCCCAGG - Intronic
1076595060 10:131620176-131620198 GGGGGGGCCTCTGCCAGCTCTGG + Intergenic
1076902889 10:133348326-133348348 GGGGATGCCCCGGACAGCCCGGG - Intronic
1077180011 11:1208067-1208089 GGGGCAGCCTCGCCCATGGCCGG - Intergenic
1077310875 11:1888585-1888607 GGGGAGCCCTCAGCCAGCGTGGG - Intronic
1077496531 11:2889479-2889501 GGGGAGGCCTCGGGCAGCCGGGG - Intronic
1081709772 11:45209233-45209255 GGGGAAGCCGCGCCCTGCACGGG - Intronic
1083674221 11:64316481-64316503 GGGGAAGCCCTGGCCACCCCAGG - Exonic
1084661664 11:70549963-70549985 GGGGAGGCCTCGGCCAGCACTGG - Intronic
1084786910 11:71448027-71448049 GGGGAAGCTCCAGACAGCGCGGG + Intronic
1088595029 11:111435037-111435059 GGGGAAGCCTGCACCAGTGCTGG - Intronic
1091589469 12:1834799-1834821 GGGGAGGCAGTGGCCAGCGCCGG - Exonic
1092181175 12:6447977-6447999 GAGGAAGCCTGGGACAGTGCAGG - Intronic
1095290410 12:40473158-40473180 GTGGAAGCCACCACCAGCGCAGG + Exonic
1101139744 12:101783001-101783023 GAGGAAGTGTCGGCCAGGGCAGG - Intronic
1102256481 12:111418434-111418456 GGGGACGCCTCGGCCTTGGCTGG - Exonic
1102354001 12:112217076-112217098 GGGCAGGCCTCCCCCAGCGCTGG + Exonic
1103562583 12:121800245-121800267 GGGGAAGCCTGGGAAAGCGGAGG - Intronic
1105344205 13:19559475-19559497 GGGGAAGCCCTGGCCACCCCAGG + Intergenic
1105535828 13:21262099-21262121 GGGGAAGCCCTGGCCACCCCAGG - Intergenic
1106087722 13:26558033-26558055 CGAGAAGCCCCTGCCAGCGCGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1110465765 13:75799018-75799040 GGGGAAGCCAGGCCTAGCGCTGG - Intronic
1112467768 13:99658652-99658674 GAGGAAGCCTCGGGCAGAGCAGG + Intronic
1113489321 13:110678952-110678974 GGTCAAGCCTCGGGCAGGGCTGG + Intronic
1118404809 14:65412745-65412767 GGGGAAGCCTCGGCCAGCGCCGG - Intronic
1119852091 14:77873427-77873449 AGGGAAGCCTCGGCAACTGCTGG + Intronic
1122418306 14:101560741-101560763 GCGGCAGCCTCGGGCAGCGGCGG + Intergenic
1125518849 15:40337399-40337421 GGAGAAGGCCCGGCCAGGGCAGG - Exonic
1131676473 15:94675233-94675255 GGAGAAGCCTGGGTCAGAGCAGG + Intergenic
1132480948 16:165871-165893 CGGGGACCCTCGGCCTGCGCCGG - Intronic
1132721438 16:1318214-1318236 GCGGGAGCCTCAGCCACCGCTGG + Intronic
1133020275 16:2964062-2964084 CGGGAAGCCCCGCCCAGCACTGG - Exonic
1135419753 16:22297749-22297771 GGGGAGGCCGCGGCCGACGCTGG + Intronic
1138456721 16:57125273-57125295 GGAGAAGCCTGGCCCAGGGCTGG - Intronic
1139475928 16:67202551-67202573 TGGGAGGCCTGGGCCAGGGCAGG + Intronic
1139853677 16:69965089-69965111 GGGAAAGACTGGGCCGGCGCCGG - Intergenic
1139882653 16:70188002-70188024 GGGAAAGACTGGGCCGGCGCCGG - Intergenic
1140369857 16:74407517-74407539 GGGAAAGACTGGGCCGGCGCGGG + Intergenic
1141757098 16:85998522-85998544 GGGGCAGCCTGGGACAGTGCAGG + Intergenic
1142400135 16:89854321-89854343 GGAGACGCCTCGGGCAGAGCTGG + Exonic
1142867482 17:2799496-2799518 TGGGAAGCCTGAGGCAGCGCTGG + Intronic
1143582771 17:7836158-7836180 GGGGAAGCCCCGGACGGCCCAGG + Intergenic
1143830235 17:9645463-9645485 GGGGCAGCCCCGCCCCGCGCGGG - Intronic
1143900674 17:10172332-10172354 GGGGAATCCTTGGGCAGGGCCGG - Intronic
1144589047 17:16508305-16508327 GAGGAAGCCTGGGCCAGCAGCGG + Intergenic
1147789812 17:43006714-43006736 GGGGAAGCCTCGGCAGGGGGCGG + Intronic
1148549753 17:48543441-48543463 GAGGAACCCGCGGCCAGCCCGGG - Exonic
1148807870 17:50273304-50273326 GTGGCAGCGTCGCCCAGCGCGGG - Intronic
1149370342 17:55987843-55987865 GGGGAAGCCTCAGCCGTCCCAGG - Intergenic
1151595236 17:75074421-75074443 GGGGAAGCCTGGGCCTGGGGTGG - Intergenic
1151759155 17:76090793-76090815 CGGGAGGCCTCGGCCAGCTGGGG + Intronic
1151853933 17:76708743-76708765 GGGGGAGCTTTGGCCAGCTCAGG + Intronic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152130401 17:78472730-78472752 GGGGAAACCAGGGCCAGCGAGGG - Intronic
1152400580 17:80064221-80064243 GGGGGAGCCGAGGGCAGCGCCGG - Intronic
1152605473 17:81287443-81287465 AGGGACGCCTCTCCCAGCGCGGG + Intronic
1152615889 17:81337617-81337639 GGGGTGGCCTCGGACAGAGCCGG + Intergenic
1153473897 18:5475934-5475956 GGGGAAGCATAGGCCAGGGAAGG - Intronic
1154385328 18:13887362-13887384 GGGGAAGCCTCGGGGATGGCAGG + Intronic
1155322382 18:24632037-24632059 TGGGAAGCCTTGGCCACCCCAGG - Intergenic
1158476456 18:57784222-57784244 GGGGAAGCCGGGGTCAGGGCGGG + Intronic
1160751442 19:736281-736303 GGGGAAGCGTGGGCCGGCGTGGG - Intronic
1160834357 19:1117574-1117596 GGGGATGCCTTGCCCAGGGCTGG - Intronic
1160874580 19:1291131-1291153 GGGGAAGCCAGGGACAGCCCTGG + Intronic
1161702958 19:5805032-5805054 GCGGACGGCTCGGCCGGCGCGGG - Intergenic
1161793794 19:6375329-6375351 GGGGCAGCCGCTGCCAGCGGTGG + Exonic
1162474861 19:10893847-10893869 GAGGAAGCCAAGGCCAGGGCTGG + Intronic
1162757324 19:12867941-12867963 GGGGAAGGCACCTCCAGCGCCGG + Exonic
1163051851 19:14690185-14690207 GGGGAGGGCTCGGCTGGCGCGGG + Intronic
1163766570 19:19166392-19166414 GGGGAATCATGGGCCAGGGCTGG + Intronic
1166432833 19:42741355-42741377 GGGGGAGCCTGGGACAGAGCAGG + Intronic
1166445819 19:42856610-42856632 GGGGGAGCCTGGGACAGGGCAGG + Intronic
1166448802 19:42880570-42880592 GGGGGAGCCTGGGACAGAGCAGG + Intronic
1166455687 19:42938069-42938091 GGGGGAGCCTGGGACAGAGCAGG + Intronic
1166482760 19:43187364-43187386 GGGGGAGCCTGGGACAGAGCAGG + Intronic
1166485234 19:43206498-43206520 GGGGGAGCCTGGGACAGAGCAGG + Intronic
1166492384 19:43270416-43270438 GGGGGAGCCTGGGACAGAGCAGG + Intergenic
1166621433 19:44304861-44304883 AGAGAAGCCGCGGCCAGCGCTGG - Intronic
1166978831 19:46621012-46621034 GGGGAATCCAGGGCCAGAGCAGG + Exonic
925005305 2:438808-438830 GAGGAACCCTCGGCCACAGCTGG + Intergenic
927962295 2:27248613-27248635 GGGGAAGCCATGTCCAGGGCAGG + Intergenic
930468190 2:51780398-51780420 CGGGAAGGCTCGGGCAGCACAGG + Intergenic
937203871 2:120223513-120223535 CGGGAAGCCGCGGCGAGCGCGGG - Intergenic
945673838 2:212832537-212832559 GGGGAAGCCCCGGCCATCCCTGG - Intergenic
947962083 2:234247971-234247993 CGGGGAGGCTCGGGCAGCGCAGG - Intergenic
948659689 2:239499288-239499310 TGGGAAGCCTCAGCCATGGCCGG - Intergenic
948913103 2:241015600-241015622 CGGGAGGCCTCAGCCAGCGCAGG - Intronic
948913112 2:241015652-241015674 TGGGAGGCCTCGGCCAGCACAGG - Intronic
948913122 2:241015704-241015726 TTGGAGGCCTCGGCCAGCACAGG - Intronic
948913131 2:241015756-241015778 CGGGAGGCCTTGGCCAGCACAGG - Intronic
1169137059 20:3203794-3203816 GGGGGAGGCTCGGCCACCGCCGG - Intronic
1169164061 20:3407521-3407543 GGGGCAGCCCCTGCCGGCGCGGG + Exonic
1172164535 20:32891043-32891065 GAGGAAGCCTGGGACAGCACTGG - Intronic
1175223577 20:57431997-57432019 GGGGAAGCGTGGGCCTGGGCTGG + Intergenic
1176221220 20:63970052-63970074 GGGGAACCACAGGCCAGCGCCGG - Intronic
1176275395 20:64263363-64263385 AGGGAAGCCTTGGCCTGGGCTGG + Intronic
1180606899 22:17065769-17065791 GTGGAAGCCACTGCCAGCTCAGG - Intergenic
1181053597 22:20249006-20249028 GTGGAGGCCTCGCCCAGCCCAGG + Intronic
1183292662 22:37012376-37012398 GGGAAAGCCATGGCCAGAGCTGG + Intronic
1183778039 22:39980682-39980704 GTGGACGCCTCAGCCAGCCCAGG + Intergenic
1184470105 22:44691374-44691396 GGGGAGGCCGTGGCCCGCGCTGG + Intronic
949125992 3:445662-445684 GGGGAGGCCTCAGGCAGCACAGG + Intergenic
950099063 3:10346182-10346204 GAGGCAGCCTGGGCCAGCCCTGG + Intronic
950444569 3:13028918-13028940 GAGGATCCCTTGGCCAGCGCAGG - Intronic
952885964 3:38011090-38011112 GGGGCTGCCTCAGCCAGCCCCGG - Intronic
954063561 3:48088698-48088720 GGGCAAGGCTCGGGCAGCCCCGG + Intronic
958814622 3:98901754-98901776 GGCCAATCCTCGGCCAGCTCTGG + Intergenic
961392066 3:126558062-126558084 GGGGAAGCCTGGGCCGGGACAGG + Intronic
966743482 3:183254344-183254366 GGGGAGGCCTCTCCCACCGCGGG + Intronic
966982964 3:185154296-185154318 GGGGAAGCCGCAGCCACCACAGG - Intergenic
967306494 3:188064607-188064629 GGAGAAGCCTTGGCCAGGGCAGG - Intergenic
968178180 3:196569009-196569031 GGGGCAGCCTCGGGCGGCGCTGG + Exonic
968273276 3:197421206-197421228 GAGGAGGCCTCGGCCCGCCCAGG + Intergenic
968811197 4:2800402-2800424 GGGGCAGGCTCGGGCAGCTCAGG - Intronic
968845986 4:3041799-3041821 GCGGAAGCCGCAGCCAGCGCCGG - Intergenic
970195634 4:13547766-13547788 GGGGAAGCCCCGGCCCTCGGGGG + Intergenic
971853133 4:32010193-32010215 GGGGCAGCCGCAGCCAGTGCTGG - Intergenic
982413151 4:155102118-155102140 GCTGAAGCCTCTGCCAGAGCTGG + Intergenic
982927200 4:161353349-161353371 AGGGAAGGCTAGGCCAGGGCAGG - Intergenic
984869079 4:184311035-184311057 TGGGAGGGCTCGGCCAACGCTGG - Intergenic
985003217 4:185505922-185505944 GGAGAAGCCTAGGTCAGGGCAGG + Intronic
985746937 5:1653097-1653119 GTGGAAGCCACTGACAGCGCCGG + Intergenic
985961393 5:3305862-3305884 GCGGGAGCCTCGGCCACTGCGGG - Intergenic
989141959 5:38210430-38210452 GGGGAAGCTTGGCCCAGCTCAGG - Intergenic
992338541 5:75798583-75798605 GGTGAAGCCTCGCCCAGCTTTGG + Intergenic
994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG + Intergenic
1001711771 5:173784568-173784590 GGGGAAGCCTGGACTAGGGCAGG - Intergenic
1002181693 5:177434107-177434129 GGGGAGGGCTCGGCCACCCCAGG + Intronic
1002233119 5:177782898-177782920 GGGGCAGCCCTGGCCAGCCCAGG - Intronic
1002262861 5:178006883-178006905 GGGGCAGCCCGGGCCAGCCCAGG + Intronic
1002328732 5:178427295-178427317 TGGGAAGCCTCGTCCATTGCTGG + Intronic
1002498932 5:179634695-179634717 AGGGGAGCCTCATCCAGCGCTGG - Intronic
1002502744 5:179657829-179657851 AGGGGAGCCTCATCCAGCGCTGG + Intergenic
1002664060 5:180810116-180810138 GGTGGGGCCTGGGCCAGCGCTGG - Intronic
1002722789 5:181273593-181273615 GGGGCAGCCCGGACCAGCGCAGG - Intergenic
1017648999 6:156564026-156564048 GGGGGAGGTTGGGCCAGCGCAGG - Intergenic
1017761946 6:157575954-157575976 GGGGAGGCCAGGGCCAGGGCGGG - Intronic
1017856932 6:158357716-158357738 GGGCAAGCCTGGGCCAGCACTGG - Intronic
1019142893 6:169959483-169959505 GGGGAAGCCGAGGGCAGGGCTGG - Intergenic
1019619857 7:1986581-1986603 GGGGAAGCCTGGAGCAGTGCGGG - Intronic
1020142377 7:5619685-5619707 GGAGAAGCCTCGCCCAGCTGAGG - Intergenic
1022097955 7:27152472-27152494 AGGGAAGCCCCGGCCAGGCCAGG - Intronic
1029490727 7:100868616-100868638 GGGGAAGGCTGGGCCAGCCGGGG - Exonic
1030084295 7:105803749-105803771 AGGGAAGTCTAGGCCAGTGCCGG - Intronic
1032513927 7:132493185-132493207 GGGGAAGGCTCAGCCAGGGCTGG - Intronic
1034441275 7:151087118-151087140 GTGGAGCCCTCGGCCGGCGCCGG - Intronic
1034823391 7:154237568-154237590 GGGGAAGCCTGGTCCAGGGAAGG - Intronic
1035078399 7:156196656-156196678 GGTGTGGCCTCGGCCAGTGCGGG + Intergenic
1035464141 7:159064119-159064141 GGGGAAGCCGCGCCCGGCGTGGG + Intronic
1035553383 8:545709-545731 GAGGAAGCCTCGCCCAGCCCTGG + Exonic
1035833949 8:2728096-2728118 GGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1037643731 8:20771664-20771686 GGGGAGGGCTGGGCCAGCTCTGG + Intergenic
1039454045 8:37696385-37696407 GGGGAAGCCTGGGGAAGCCCTGG - Intronic
1040564722 8:48555224-48555246 GGAGAAGCCTGGCCCAGCCCGGG + Intergenic
1040571439 8:48614976-48614998 GGAGAAGCCGCGGCCAGCACTGG - Intergenic
1040583467 8:48716396-48716418 GGGCAGGCCTAGGCCAGAGCCGG - Intronic
1041109361 8:54470353-54470375 GGGCAGGCCTGGGGCAGCGCGGG - Intergenic
1042200517 8:66276088-66276110 GGGGAAGCCTCATCCAGCAGAGG + Intergenic
1042743543 8:72077298-72077320 GGGGCAGCGTGGGCCAGTGCAGG + Intronic
1045259419 8:100559413-100559435 GGGGAACCCCTGGGCAGCGCGGG - Intronic
1048272420 8:133040166-133040188 GGGGACGCCTCAGCCAGTGTGGG + Intronic
1049049820 8:140185671-140185693 GGGGAAGCCTCCACCAGCGAGGG + Intronic
1049311032 8:141933974-141933996 GGGGCAGCCTCTACCAGGGCAGG + Intergenic
1049339534 8:142104663-142104685 GGGGAAGCCCCGGGCAGCACAGG + Intergenic
1049377998 8:142298184-142298206 GGAGAGGCCTGGGCCAGGGCGGG - Intronic
1049385333 8:142340247-142340269 GGACATGCCTCGGCCAGGGCTGG - Intronic
1049389069 8:142358894-142358916 GGAGAGGGCTGGGCCAGCGCAGG - Intronic
1049463145 8:142739331-142739353 GGGGAGGCCACGGCCAGGGAGGG - Intergenic
1049531188 8:143156485-143156507 AGGGAAGCCTTGGCCAGCTAGGG - Intergenic
1053002749 9:34586240-34586262 GGGGAAGCCTAGGCATGCCCTGG + Intronic
1053157603 9:35791691-35791713 GAGGAAGCGCCGGGCAGCGCCGG + Intergenic
1053885019 9:42637207-42637229 GGGGAAGCCCGGACCAGCTCAGG - Intergenic
1054144477 9:61552119-61552141 GGGGAAGCCGCAGGCAGAGCAGG + Intergenic
1059098214 9:111442310-111442332 AGGGAAGCCTCAGCCACAGCAGG - Exonic
1059365101 9:113780809-113780831 GGGGAGGCCTGGGGCAGGGCGGG - Intergenic
1059774806 9:117464432-117464454 TGGGAAGCCACGGCCATCGATGG + Intergenic
1060827178 9:126693910-126693932 GGGTGAGCCTGGGCCAGGGCTGG + Intronic
1061604277 9:131697160-131697182 GGAGAAGCCTGGGCCAGCAGAGG - Intronic
1062021297 9:134320599-134320621 TGGGAAGACACGGCCAGCCCAGG + Intronic
1062112488 9:134789789-134789811 AGGGAGGCCTGGGCCAGCGGGGG - Intronic
1062177810 9:135173917-135173939 GGGGCAGCATCTGCCAGCCCAGG - Intergenic
1062597637 9:137306316-137306338 GCGGAAGCCTCGGGCAGCAGGGG - Intergenic
1203790724 EBV:150308-150330 GGGTAAGCTTCGGCCATGGCCGG + Intergenic
1195716899 X:107826529-107826551 GGAGAGCCCTCGGCCAACGCCGG - Intronic
1197978795 X:132194382-132194404 GGGGAGGCTTCGGCCAGCGCAGG - Intergenic
1199628060 X:149758525-149758547 GAGGGAGCCTCCGCCAGCCCAGG - Intergenic
1200065689 X:153503182-153503204 GGGGAAGCATCGGGCAGGGCGGG + Intronic
1200238217 X:154479318-154479340 GGGGAAGGCCCCGCCAGCGCAGG - Intergenic