ID: 1118410879

View in Genome Browser
Species Human (GRCh38)
Location 14:65476284-65476306
Sequence CAGGCCTCCCTGAAGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118410879 Original CRISPR CAGGCCTCCCTGAAGTTTAG GGG (reversed) Intronic
900616539 1:3568041-3568063 CAGGCCTCTCTGGCGTTTATGGG - Intronic
900906711 1:5564522-5564544 CAGGGATCCCTGAAGTAAAGGGG - Intergenic
901062332 1:6477594-6477616 CAGGCCTCGCAGAGGTTGAGGGG + Exonic
901808140 1:11750539-11750561 CAGGCCTCCCCCAAGTTTGCTGG + Exonic
904293426 1:29502492-29502514 CAGGCCTCTCTGGAGGTCAGTGG + Intergenic
905822384 1:41003757-41003779 CAGACCTCCCTAAAGCTCAGTGG + Intronic
907369737 1:53993015-53993037 CAGGCATCCCTGCACTTTGGGGG - Intergenic
907714165 1:56912311-56912333 CAGGCCTTCCAGAAGCTTGGTGG + Intronic
907898919 1:58719717-58719739 CAAGCCTCCCTGAAGCTAGGTGG - Intergenic
908295006 1:62705013-62705035 CAGGCCTCCTTGAAATGTGGTGG + Intergenic
910539764 1:88342346-88342368 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
912743254 1:112221915-112221937 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
913033142 1:114932918-114932940 CAGGCCTCCTTGAGCTGTAGTGG - Intronic
915591928 1:156875645-156875667 CAGGCATCACTGAAGTATTGTGG - Exonic
915891074 1:159774439-159774461 CTAGCCTCCCTGTAGCTTAGGGG - Intergenic
915940332 1:160114739-160114761 CAGGCCTCTCTGCAGTGAAGTGG - Intergenic
916174220 1:162024122-162024144 GCGGCGTCCCTGAAGTTTTGGGG + Intergenic
916445081 1:164864570-164864592 CTGCCATCCCTGAAGTTTATAGG - Intronic
916627104 1:166570220-166570242 AAGGCCTCCATTCAGTTTAGGGG + Intergenic
916890545 1:169108407-169108429 CAGGCCTCCCTCAAGTTACAAGG - Intronic
917068955 1:171128274-171128296 CAGGCCTGCCTGAGATTTAAGGG + Intergenic
917316014 1:173726269-173726291 CAGGCCTCCTTGAACTGCAGTGG - Intronic
917391786 1:174545223-174545245 CAGGCCTCCTTGAGCTTTGGTGG + Intronic
920389339 1:205589259-205589281 CAGGCCTGGCTGAAGTTCAAAGG + Intronic
1065943620 10:30587428-30587450 CATGCCTCTCTGGAGTTGAGAGG - Intergenic
1067213166 10:44278791-44278813 CAGGTTTCCCTGAAGTTTGGTGG + Intergenic
1067810696 10:49425237-49425259 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1069199279 10:65592718-65592740 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
1071284025 10:84127755-84127777 CATGCCTCCCTGAGGATTGGGGG - Intergenic
1071352626 10:84762356-84762378 CAGGCCTCCCTGAACTGTGGTGG + Intergenic
1071370150 10:84942945-84942967 CAAGCCACCCTACAGTTTAGCGG - Intergenic
1071459326 10:85877125-85877147 CAGGCCTCCCTGAGCTGTGGTGG - Intronic
1071743367 10:88387653-88387675 CAGGGCTCCCAGAAGTTAAATGG + Intronic
1071819526 10:89265245-89265267 TAGGCATCCCTGCAGTTTGGGGG - Intronic
1075446572 10:122517585-122517607 CAGGCCTCGCTGAGGTTGTGTGG + Intergenic
1076404838 10:130204874-130204896 CAGGCCTCCCTGAGGGTGATGGG + Intergenic
1077378494 11:2216527-2216549 CCGGGCTCCCTGCTGTTTAGAGG - Intergenic
1078079237 11:8192228-8192250 CAGGCTGCCCTGAAGTCTGGAGG - Intergenic
1078904462 11:15671266-15671288 CAGGTGGCCCTGAAGTGTAGTGG - Intergenic
1080488026 11:32731296-32731318 CAGGCCTCCATGAACTGTGGTGG - Intronic
1081405070 11:42688528-42688550 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
1083006265 11:59349785-59349807 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1085170549 11:74446014-74446036 CAGGCCTCTCAGAAATTAAGAGG + Intergenic
1086529182 11:87764007-87764029 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1087299007 11:96411126-96411148 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1088177209 11:107066953-107066975 CAGGACTCTCTGGAGTTTACAGG + Intergenic
1089143718 11:116309121-116309143 CAGGGCTCCCTGGAGTTGGGCGG - Intergenic
1089467399 11:118694199-118694221 CTGGCCACCCTGAACTGTAGGGG - Intergenic
1092226620 12:6752469-6752491 AGGGTCTCCCTGGAGTTTAGGGG - Intronic
1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG + Intergenic
1093493098 12:19726499-19726521 CAGGCCTCCCTGTGCTTTTGGGG - Intergenic
1095060442 12:37682116-37682138 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
1096044877 12:48553824-48553846 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1096111688 12:49032561-49032583 CGGCCCTCCCTGATGTGTAGAGG + Exonic
1097578163 12:61420596-61420618 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1097961371 12:65534814-65534836 CAGGCTTCCCTGAAGTTCAGTGG + Intergenic
1098756106 12:74365332-74365354 CAGACCACACAGAAGTTTAGTGG + Intergenic
1099720560 12:86356844-86356866 CAGGCCTCCTTGAGCTTCAGTGG - Intronic
1101740423 12:107495648-107495670 AGGGCTTCCCTGAAGTTCAGGGG - Intronic
1102400177 12:112621701-112621723 CAGGCCTCCTTGAACTGTGGTGG - Intronic
1103861401 12:124017351-124017373 CAGGCCTCCCTGCCCCTTAGGGG - Intronic
1104939807 12:132389844-132389866 CAGGCCTCCCAGCACCTTAGAGG + Intergenic
1105875982 13:24554034-24554056 CAGGCCTCCCTGAGCTGCAGTGG + Intergenic
1106445758 13:29829307-29829329 CAGGCCTCCCTGAGCTGTGGTGG + Intronic
1106537526 13:30660395-30660417 CAGGCATCCCTGCACTTTTGGGG - Intronic
1106836506 13:33640873-33640895 TTGGCCTCCCTGAAGTTCAAAGG + Intergenic
1107697366 13:43013323-43013345 CTCCCCTCCCTGAAGGTTAGGGG - Intergenic
1109823306 13:67685763-67685785 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1111214398 13:85123699-85123721 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
1111783007 13:92752983-92753005 CAGGCCTCCCTGAGCTGTGGTGG - Intronic
1113488122 13:110670081-110670103 CAGGCCTCCTTGAGCTGTAGTGG - Intronic
1114801843 14:25784353-25784375 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1114824996 14:26066352-26066374 CTGGCTTCCCTGAAGTTAATGGG + Intergenic
1115335376 14:32240219-32240241 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1115524497 14:34266368-34266390 CTGGCTTCACTGAATTTTAGGGG - Intronic
1116198310 14:41757375-41757397 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1116696761 14:48187589-48187611 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
1116736428 14:48697665-48697687 CAGGCCTCCTTGAACTGTAGTGG - Intergenic
1118410879 14:65476284-65476306 CAGGCCTCCCTGAAGTTTAGGGG - Intronic
1119093547 14:71807216-71807238 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1121156334 14:91688423-91688445 CAGTGCTCCCTGGAATTTAGTGG + Intronic
1121695404 14:95908273-95908295 CAGGCCTCCCTGCACTCTTGGGG - Intergenic
1123218319 14:106832340-106832362 CTGCCCTCCCTGAAGTCTAGAGG - Intergenic
1124345712 15:28920190-28920212 CAGGCATCTCTGAATTCTAGGGG - Intronic
1127956377 15:63857418-63857440 AAGGCCTCACTGTTGTTTAGGGG - Intergenic
1128014127 15:64327167-64327189 CAGGCCTCCTTGAGGTGTGGTGG - Intronic
1128716214 15:69910048-69910070 CACTCCTTCCAGAAGTTTAGAGG - Intergenic
1129132575 15:73513943-73513965 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1129377845 15:75145386-75145408 CAGGCCTCCCTGTGCTTTTGGGG - Intergenic
1130197950 15:81798437-81798459 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
1130850813 15:87791953-87791975 CAGGCATTCCTGAACTTTTGGGG - Intergenic
1130922282 15:88357579-88357601 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
1131726095 15:95226844-95226866 CAGGACTTCCTAAAGTTTAAAGG - Intergenic
1133401512 16:5490674-5490696 CAGGCCTCCTTGAAGTTTCCGGG - Intergenic
1133761796 16:8804657-8804679 CAGTCCTTGCTGGAGTTTAGCGG + Intronic
1136412202 16:30083987-30084009 CATGGCTCCCTGAAGTGAAGGGG + Intronic
1136907875 16:34118976-34118998 CAGGCCTCCTTGAACTATGGTGG - Intergenic
1137808557 16:51330318-51330340 CAGGCCTCCCTGAGCTGTGGTGG - Intergenic
1140168779 16:72581299-72581321 CAGGCCTCCTTGAGCTTTGGTGG - Intergenic
1140179080 16:72695997-72696019 CAGGCCTCCTTGAGGTTTGGTGG + Intergenic
1140597202 16:76430620-76430642 CAGGCCTTCCTCAAGCTCAGGGG - Intronic
1140893892 16:79308337-79308359 ATGGCCTCTCTGAAGTTTGGAGG - Intergenic
1146420792 17:32683748-32683770 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1146610132 17:34297948-34297970 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1146825511 17:36019184-36019206 CTCCCCTCCCTGGAGTTTAGGGG + Intergenic
1148215596 17:45832586-45832608 CAGGCCTCCCTGGAGCTTGCTGG + Intronic
1148360147 17:47004955-47004977 CAGGCCACTCTGAAGCTAAGGGG - Intronic
1153874734 18:9359060-9359082 CAAACCACCCTAAAGTTTAGTGG + Intronic
1154181136 18:12140972-12140994 CAGGCCTCCTTGAATTGTGGTGG + Intergenic
1157609252 18:48946012-48946034 CAGGCCTCCCAGATGCTGAGTGG + Intronic
1158054305 18:53260821-53260843 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1158114457 18:53979317-53979339 CAGGCCTCCTTGAACTGCAGTGG + Intergenic
1160677240 19:397959-397981 CAGGCCTCCTTGGAATTTTGGGG + Intergenic
1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG + Intergenic
1164321595 19:24153175-24153197 CAGGCCTCCTTGAGCTTTGGTGG + Intergenic
1164917133 19:32060850-32060872 CAGGCTTCCCTGGGGTATAGAGG - Intergenic
925948804 2:8892181-8892203 CAGACTTCCCTTAAGCTTAGTGG - Intronic
926296424 2:11572340-11572362 GAGGCATCCCTGAGGTTTTGTGG + Intronic
926778653 2:16447233-16447255 CAGCCCTCCTTGATGTTTATAGG + Intergenic
927487188 2:23496564-23496586 CTGGCCCCGCTGAAGGTTAGAGG - Intronic
928487679 2:31749033-31749055 CAGGCCTCCCTGAGGTGCGGTGG - Intergenic
928837838 2:35568673-35568695 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
929788204 2:45006814-45006836 CAGGGTTCCCTGAAGTTGTGGGG + Intronic
930207508 2:48602698-48602720 TTGGGCTCCCTGGAGTTTAGAGG + Intronic
930972944 2:57419214-57419236 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
931252470 2:60545487-60545509 AAGGCTTCCCTGAAGTAGAGTGG - Intronic
932201200 2:69829859-69829881 CTGGGCTCCCTGAAGTCTCGGGG + Exonic
932642266 2:73460961-73460983 CAGGCCTCCTTGAGCTGTAGTGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935938113 2:108208752-108208774 CAGGCCTCCCTGAGCTGCAGTGG + Intergenic
937299637 2:120831372-120831394 CAGGCCTCCCTGGAGGTTACAGG + Intronic
938651517 2:133388654-133388676 CAGGCCTCCTTGAACTGTGGTGG + Intronic
939072007 2:137555066-137555088 CAGGCCTCCTTGAACTGCAGTGG - Intronic
942790701 2:179757580-179757602 CAGGCCTCCTTGAACTGCAGCGG + Intronic
945677754 2:212876205-212876227 CAGGCCTCCCTGAGCTGCAGTGG - Intergenic
945873542 2:215253477-215253499 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
948992854 2:241563543-241563565 CAGGATTCCCTGAAGCTTGGAGG + Intronic
1169029204 20:2395075-2395097 AAAGCCTCCCAGAAGTTCAGGGG + Intronic
1170419400 20:16177894-16177916 CAAACCACCCTGAAATTTAGTGG + Intergenic
1172618868 20:36306901-36306923 CAGGCCGCCCTGCGGATTAGGGG - Intronic
1175099663 20:56570009-56570031 CAGACCTCCCTGCTGTTCAGAGG - Intergenic
1176431321 21:6578173-6578195 CAGGCCTCCCTGAAAGTTTGGGG - Intergenic
1176582417 21:8543607-8543629 CAGGCCTCCCTGCACTCTTGGGG - Intergenic
1178411924 21:32371100-32371122 AAGGCCTCCCTGAAGTGGTGAGG + Intronic
1179706715 21:43185635-43185657 CAGGCCTCCCTGAAAGTTTGGGG - Intergenic
1180265249 22:10520655-10520677 CAGGCCTCCCTGCACTCTTGGGG - Intergenic
1185360273 22:50402499-50402521 CAGGCCTCTCTGGAGTTCTGTGG + Intronic
949413411 3:3791254-3791276 CAGGCCTCCCTGAAGTTCATGGG - Intronic
949698082 3:6722095-6722117 GAGGCTTCCTTGATGTTTAGGGG + Intergenic
949701991 3:6769636-6769658 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
951198897 3:19855555-19855577 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
952680234 3:36083242-36083264 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
954299205 3:49690408-49690430 CTGGCCTCACTGATGTGTAGCGG - Intronic
954982250 3:54756865-54756887 CAGGCCTCCCTGGATTTTGCTGG - Intronic
956056189 3:65301241-65301263 CTCCCCTCCCTGAAGGTTAGGGG + Intergenic
957174272 3:76785417-76785439 CAGGTCTTCCTAAAGTATAGTGG + Intronic
957601256 3:82338006-82338028 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
957808343 3:85182235-85182257 CAGCCCTCACTGAAGATGAGAGG - Intronic
958165516 3:89874545-89874567 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
959812663 3:110637522-110637544 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
960634341 3:119768532-119768554 CAGGCATCCCTGAACTCTTGGGG - Intergenic
962396172 3:135016965-135016987 CAGGCATCCCTGAAGCTTGAAGG + Intronic
962537634 3:136344552-136344574 AAGGCTTCCCTGAAGTACAGAGG - Intronic
962720450 3:138169172-138169194 CAGGACTTCCCAAAGTTTAGTGG - Intronic
962831690 3:139147806-139147828 CAGGCCTCCTTGAACTGTGGTGG + Intronic
965659413 3:171025594-171025616 CAGGCCTCACAGCAGTTTAGTGG + Intronic
965715222 3:171595476-171595498 CAGGCATGTCTGGAGTTTAGGGG + Intergenic
967882223 3:194309855-194309877 CAGCCCTCCATGAAGCTTCGTGG + Intergenic
968745933 4:2360071-2360093 GAGGCCTCCATGATGTCTAGGGG + Intronic
969695323 4:8730992-8731014 CAGGCTTGGCTGAAGTTTAAGGG - Intergenic
970027022 4:11634488-11634510 CAGGCTTCCCTGAAACTAAGGGG - Intergenic
972246993 4:37255691-37255713 CAGTCCTCCCTTATGATTAGGGG - Intronic
973204896 4:47549470-47549492 CAGGCACCCCTGAAGGTAAGAGG - Intronic
973630652 4:52816963-52816985 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
973648169 4:52970540-52970562 CAGGCCTCCTTGAGCTTCAGTGG - Intronic
973704201 4:53565141-53565163 CAGGCCTCCCTGAGCTGTGGTGG - Intronic
973874756 4:55206412-55206434 AAGGCCTCCCTGAGGTGTGGTGG - Intergenic
974530153 4:63097925-63097947 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
975250181 4:72169396-72169418 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
975824643 4:78307362-78307384 CAGGCCTCCTTGAACTGTGGTGG + Intronic
977023926 4:91791528-91791550 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
977029488 4:91863936-91863958 CAGGCCTCCTTGAGCTTTGGTGG + Intergenic
977619160 4:99117293-99117315 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
980008140 4:127564830-127564852 TAAGCCTCCCCGAAGCTTAGTGG - Intergenic
980217964 4:129876358-129876380 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
980503948 4:133690813-133690835 CAGGCCTCCTTGAACTGCAGTGG + Intergenic
981345668 4:143673710-143673732 CAGGCCTCCTTGAGCTTTGGTGG + Intronic
981494823 4:145379295-145379317 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
986674366 5:10170095-10170117 CATAACTTCCTGAAGTTTAGGGG - Intergenic
988940309 5:36139100-36139122 CAGGCATCCCTGCACTTTCGGGG + Intronic
989614721 5:43328500-43328522 CAGGCCTCCTTGAACTGCAGTGG + Intergenic
989828385 5:45886732-45886754 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
989843605 5:46111828-46111850 CAGGCCTCCCTGAACTGTGTTGG + Intergenic
990860362 5:60320100-60320122 CAGGCCTCCTTGAGCTGTAGTGG + Intronic
991555449 5:67890112-67890134 CAGGCCTCCCTGAGCTGTGGTGG - Intergenic
991958831 5:72021571-72021593 CAGGGCTCCCTCCAGTATAGAGG - Intergenic
992338476 5:75798246-75798268 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
992922875 5:81545067-81545089 CTGGCCACCCTAAAGTGTAGAGG - Intronic
993446207 5:88015090-88015112 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
993798723 5:92302457-92302479 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
994160913 5:96555748-96555770 CAGGCCTCCTTGAGCTGTAGTGG - Intronic
995340006 5:111047937-111047959 CTGCCCACCCTGCAGTTTAGTGG - Intergenic
996751709 5:126895810-126895832 CAGGCCTCCCTGAGCTGTGGTGG + Intronic
998324657 5:141269199-141269221 CTGTCCTCTCTGAAGTTTTGGGG + Intergenic
1002335902 5:178478139-178478161 CAGGCCTCCCTGAACCTCACTGG + Intronic
1003239783 6:4334232-4334254 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1004295340 6:14405072-14405094 TCTGCCTCCCTGAAGTTGAGTGG + Intergenic
1004553742 6:16675094-16675116 CAGAGCTCTCTGAAGTCTAGGGG + Intronic
1004960535 6:20783523-20783545 CAGGCCTCCCTGTAGGTTGAAGG + Intronic
1005101845 6:22180356-22180378 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1006500482 6:34455804-34455826 CAAACCACCCTAAAGTTTAGTGG + Intergenic
1007137192 6:39533529-39533551 CAGGCCTCCTTGAACTGTGGTGG - Intronic
1007520249 6:42446409-42446431 AAGGCCTCTCTGAGGTTTGGGGG - Intronic
1008311167 6:49976067-49976089 CAGGCATCACTTAATTTTAGAGG - Intergenic
1009282451 6:61769708-61769730 CAGGCCTCCTTGAACTGTGGTGG - Intronic
1009870287 6:69445039-69445061 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1010187068 6:73156990-73157012 CGGGCCTCCCTGAAGCGTGGTGG + Intronic
1010307631 6:74343405-74343427 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1010790038 6:80053992-80054014 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1010876888 6:81117664-81117686 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1012969766 6:105716631-105716653 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
1013906185 6:115222590-115222612 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
1014159093 6:118146682-118146704 CCTGCCTCCAGGAAGTTTAGAGG - Intronic
1014624077 6:123704509-123704531 CAGGATTCACTGAAGTTCAGAGG + Intergenic
1014827091 6:126058922-126058944 TAGGCCTCTCTGAGGTATAGAGG - Intergenic
1016201248 6:141411355-141411377 CTGGTTTCCCTGAAGTTTAACGG + Intergenic
1016365128 6:143307829-143307851 CAGGCCTCCCTGAGCTGTGGTGG + Intronic
1018047515 6:159978540-159978562 CAGGCCTCCCTGGAGGGTGGAGG + Intronic
1020374125 7:7465598-7465620 CAGGCCTCCTTGAGCTGTAGTGG - Intronic
1022204894 7:28154087-28154109 AAAGCCTCCCCGAAGTTTTGGGG + Intronic
1023840354 7:44093692-44093714 AGGGCCTCCCAGAAATTTAGAGG + Intergenic
1024331138 7:48156449-48156471 CAGGACACTCTGAAGTTCAGAGG + Intergenic
1024580480 7:50796723-50796745 CAGGCCACCCTGGAGTCTAGAGG + Intergenic
1025554076 7:62281503-62281525 CATGCTTCCCTGAATTTTAAGGG - Intergenic
1025560705 7:62371771-62371793 CATGCTTCCCTGAATTTTAAGGG + Intergenic
1026233220 7:68503697-68503719 CAGACCTCCCTGAAGGATAAAGG - Intergenic
1028022229 7:85791403-85791425 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
1028369067 7:90070454-90070476 CAGGCCTCCTTGAGCTTCAGTGG - Intergenic
1029214201 7:98933826-98933848 CAGCACCCCCTGAAGTGTAGGGG + Intronic
1030101947 7:105954899-105954921 CAGGCATGCCTGGAGTTCAGTGG + Intronic
1030105002 7:105979681-105979703 AAGGCCACCCAGAAGTTCAGTGG + Intronic
1030131987 7:106209230-106209252 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
1030504505 7:110403122-110403144 TAGGCGTCCCTGGAGTTTTGTGG + Intergenic
1033401825 7:141033104-141033126 CAGGCCTCCCTGAGCTGTGGTGG - Intergenic
1033533940 7:142294547-142294569 CAGGCCTTCCTGAACTTTCTAGG + Intergenic
1034371103 7:150597609-150597631 CAGGCCTCCCTGAGCTGTGGTGG - Intergenic
1034499213 7:151439428-151439450 CAGACCTCCCTGAAGGTTTCAGG - Intronic
1035318190 7:158010819-158010841 AAGGCCTCACTGAAATTTAAAGG - Intronic
1035361278 7:158315461-158315483 CAGGACTCCCTGAAGGATAGAGG + Intronic
1035380514 7:158437547-158437569 CAGGCCTCCCTTGAGTTAAGGGG - Intronic
1036745690 8:11407592-11407614 CAGGCCTCCTTGAGTTGTAGTGG + Intronic
1038434589 8:27526388-27526410 CAGGCCTCCCTGTAGTATGTGGG - Intronic
1040405751 8:47100452-47100474 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1040428794 8:47317475-47317497 CAGGCCTCCTTGAACTGTGGTGG - Intronic
1041338256 8:56812195-56812217 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1041861692 8:62521168-62521190 CAGGCCTTCCTGAAGGATAGCGG + Intronic
1042800562 8:72713183-72713205 CAGGCCTCCTTGATCTTTGGTGG - Intronic
1043411687 8:80004009-80004031 CAGGCCTCCTTGAGCTTTGGTGG - Intronic
1044704769 8:94997910-94997932 CAGACCTCCCTGAAGATCTGTGG + Intronic
1045079959 8:98614954-98614976 CAGGCCTCCTTGAACTCTGGTGG - Intronic
1045143521 8:99313786-99313808 CAGGCTTCCTTGAACTTTGGTGG + Intronic
1045293452 8:100852830-100852852 CAGGCCTCCTTGAACTGTGGTGG - Intergenic
1046063939 8:109174807-109174829 CAGGCATCCCTGAAGCATATTGG - Intergenic
1046458655 8:114504526-114504548 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
1046464664 8:114585844-114585866 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1046468474 8:114636788-114636810 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1046968441 8:120193672-120193694 CAGGCCTCCTTGAGCTGTAGTGG + Intronic
1050483889 9:6114245-6114267 CAGGCATCCCTGCACTTTTGGGG + Intergenic
1052396889 9:27949542-27949564 CAGCCCACCCTGCAGTTTGGTGG - Exonic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053444977 9:38145922-38145944 CAGGCCTCTCTGCACTCTAGGGG + Intergenic
1053447327 9:38163163-38163185 CAAGCCTCCCTGGAGCTTACAGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054811690 9:69440401-69440423 CAGGCCTCCTTGAGCTGTAGTGG + Intronic
1055300238 9:74875243-74875265 CAGCCCTCCTTCAAGTTTAATGG - Intronic
1055866134 9:80816367-80816389 CAGGCCTCCCTGAGCTGCAGTGG - Intergenic
1056448042 9:86685676-86685698 AAGGCTTCCTTGAAGTTGAGTGG - Intergenic
1057228813 9:93306529-93306551 CACTTCTCCCTGAAGCTTAGGGG + Intronic
1057342724 9:94217246-94217268 CAGGCCTCCTTGAGCTTCAGTGG - Intergenic
1057946791 9:99337535-99337557 CAGGCCATCCCAAAGTTTAGTGG + Intergenic
1058353944 9:104060151-104060173 CAGGTCTCACAGAAGTTTAAGGG - Intergenic
1058498046 9:105581665-105581687 CAGGCCTCCTTGAACTGTGGTGG + Intronic
1060204801 9:121676126-121676148 CAGGCCTGCCTGGAGGTCAGCGG + Intronic
1061094996 9:128451384-128451406 CAGGCCACCCCGAAGCTCAGAGG - Intergenic
1061803259 9:133123631-133123653 CAGGCTTCCCAGAAGTTGGGAGG - Intronic
1061896713 9:133652141-133652163 CAGGCCTCCCTGACCTCTGGGGG - Intronic
1187223024 X:17347980-17348002 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1187304116 X:18079591-18079613 CAAGTCTCCCTGAAATTTGGAGG - Intergenic
1188778677 X:34253384-34253406 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1188840988 X:35017118-35017140 CATGCCTCCCTGAAGTCCTGTGG + Intergenic
1189856498 X:45229618-45229640 CAGGCCTCCCTGTGCTTTTGGGG - Intergenic
1190159621 X:48021832-48021854 GAGGCCTCCCTGAGGCCTAGGGG + Intronic
1190554866 X:51623640-51623662 CAGGCCTCCTTGAGCTTCAGTGG - Intergenic
1190760225 X:53432462-53432484 CTGCCCTCCCTCAGGTTTAGTGG - Intronic
1190953683 X:55171255-55171277 CAGCCCTCCCAGAAGTTGAAGGG + Intronic
1191114853 X:56841793-56841815 CAGGCCTCCCTGAGCTGTGGTGG + Intergenic
1191579327 X:62742804-62742826 CAGGCCTCCTTGAGCTGTAGTGG - Intergenic
1191589899 X:62870835-62870857 CAGGCCTCCTTGAACTGCAGTGG + Intergenic
1191745652 X:64483987-64484009 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1191982669 X:66943298-66943320 CAGGCCTCCCTGAGCTGTGGTGG - Intergenic
1192255032 X:69448877-69448899 CAGGCCTCCTTGAGCTTTGGTGG - Intergenic
1192287664 X:69755682-69755704 CAGGCCTCCTTGAGCTTTGGTGG + Intronic
1192606833 X:72527321-72527343 CAGGCCTTTCTGAAGTATTGAGG - Intronic
1192674906 X:73185355-73185377 CAGGCCTCCTTGAGCTTCAGTGG - Intergenic
1192931411 X:75810417-75810439 CAGGCCTCCTTGAGCTGTAGTGG + Intergenic
1193010017 X:76665902-76665924 CAGGCCTCCTTGAGGTGTGGTGG + Intergenic
1194284317 X:91990819-91990841 GTGGCCTCCCTGAACTTTGGGGG + Intronic
1194658130 X:96598139-96598161 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
1195061907 X:101204607-101204629 CATGCATCCCTGAACATTAGTGG - Intergenic
1195088961 X:101440592-101440614 CAGGCCTCCTTGAACTTTGGTGG + Intronic
1195203767 X:102574811-102574833 CAGGCCTCCTTGAGGTGTGGTGG - Intergenic
1198755051 X:139973892-139973914 CAAGCCACCCTAAAATTTAGTGG - Intergenic
1198757191 X:139994634-139994656 CAGGCCTCCTTGAGCTTTGGTGG + Intergenic
1200357633 X:155568354-155568376 CAGGCCTCCTTGAACTGTGGTGG - Intronic
1201397482 Y:13564767-13564789 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1201494260 Y:14576207-14576229 CAGGCCTTCTTGAAGTGTGGTGG + Intronic
1201936724 Y:19418495-19418517 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1201969871 Y:19780171-19780193 CAGGCCTCCTTGAGGTGCAGTGG - Intergenic
1202242080 Y:22781271-22781293 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1202395064 Y:24415015-24415037 CAGGCCTCCTTGAACTGTGGTGG + Intergenic
1202475720 Y:25255077-25255099 CAGGCCTCCTTGAACTGTGGTGG - Intergenic