ID: 1118417843

View in Genome Browser
Species Human (GRCh38)
Location 14:65562770-65562792
Sequence CTAAAGGCTTTCTGTACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118417843_1118417851 24 Left 1118417843 14:65562770-65562792 CCAATTGTACAGAAAGCCTTTAG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1118417851 14:65562817-65562839 CAGAGCTGTTACGGAAACTGAGG 0: 1
1: 0
2: 1
3: 8
4: 165
1118417843_1118417850 15 Left 1118417843 14:65562770-65562792 CCAATTGTACAGAAAGCCTTTAG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1118417850 14:65562808-65562830 ATAGTGGGACAGAGCTGTTACGG 0: 1
1: 0
2: 0
3: 9
4: 94
1118417843_1118417848 -1 Left 1118417843 14:65562770-65562792 CCAATTGTACAGAAAGCCTTTAG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1118417848 14:65562792-65562814 GAATAGTTGGGGAAGAATAGTGG 0: 1
1: 0
2: 1
3: 18
4: 248
1118417843_1118417849 0 Left 1118417843 14:65562770-65562792 CCAATTGTACAGAAAGCCTTTAG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1118417849 14:65562793-65562815 AATAGTTGGGGAAGAATAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118417843 Original CRISPR CTAAAGGCTTTCTGTACAAT TGG (reversed) Intronic
901544630 1:9946557-9946579 CCAAAGGCTCTCTGAACACTTGG + Intronic
902587615 1:17450450-17450472 CAAAAGGCTTTCTGTGGATTGGG - Intergenic
905093068 1:35445255-35445277 CTAAAAGCTTGCTGCACAGTGGG + Intronic
905590557 1:39159512-39159534 ACAAAGGCTTACTTTACAATGGG - Intronic
906437559 1:45810090-45810112 CTAAAGGCTTTGCTCACAATAGG + Intronic
908513128 1:64865671-64865693 CTGAGGGTTTTCTGTATAATAGG - Intronic
908657660 1:66405054-66405076 CTTAAAGCTTCCTGTACCATAGG - Intergenic
911240213 1:95457094-95457116 CTAAAGACTTTCAATAAAATAGG + Intergenic
912282058 1:108326389-108326411 CTTAAGCATTTCTGTACAACAGG + Intergenic
916537679 1:165719201-165719223 CTAATGTCTTTCTGGAAAATTGG + Intergenic
921692030 1:218163357-218163379 CTACAGTCTTTGTGGACAATAGG - Intergenic
1065571824 10:27079145-27079167 CTAAAGGCTTTCTGGCAAACCGG - Exonic
1067722791 10:48742240-48742262 CTAATTGCTTTCTGCACACTTGG + Intronic
1069235154 10:66061978-66062000 GTAAAGTCTTGTTGTACAATGGG + Intronic
1071706718 10:88007121-88007143 CTAAAGGCTTCCTGTAGAAAGGG + Intergenic
1073623253 10:105070896-105070918 CTAAACTTTTTCTGTACAACTGG - Intronic
1074352708 10:112753855-112753877 CTAAAGGGTTTCTTTCCAAAAGG - Intronic
1078634753 11:13039012-13039034 CTAAAGGCTATAATTACAATGGG + Intergenic
1081720775 11:45286492-45286514 CTTAATGCTTTGTGTACAACAGG + Intergenic
1082242872 11:49889901-49889923 CCCAAGGCTTACTGTAGAATTGG + Intergenic
1085282212 11:75338537-75338559 CTCAGGTCTTTCTGTACACTGGG + Intronic
1085902759 11:80721607-80721629 TTAAAGGCTTTCTGTGGAAGAGG - Intergenic
1087003693 11:93446896-93446918 TTAAAGGTGCTCTGTACAATAGG + Intergenic
1089906845 11:122048802-122048824 CTTCAGGTTTTCTGTAAAATGGG - Intergenic
1092756889 12:11771989-11772011 CTAAGGGCTTTCAATATAATTGG - Intronic
1093654374 12:21677666-21677688 CAGAAGGCTTTCTGTACCCTGGG - Intronic
1094619057 12:32062664-32062686 GTAAATGATTTCTGTCCAATTGG + Intergenic
1095459092 12:42423287-42423309 CTGAAGGCATTATGTACAGTGGG - Intronic
1098437334 12:70481824-70481846 TTAAAGGCTTCCTGTTCAAGAGG + Intergenic
1098503260 12:71219306-71219328 CTAAAGGCTTAATCTTCAATTGG - Intronic
1099160543 12:79236165-79236187 CTGAAAGATTTATGTACAATGGG - Intronic
1099284466 12:80699801-80699823 ATAAAGGCTTTCTTTATAAATGG + Intergenic
1099346456 12:81506040-81506062 CTAAATGCTTACTGTACATCAGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1099890000 12:88579575-88579597 ATAAAGGCTTTTTATAAAATAGG - Intronic
1100727339 12:97422771-97422793 CTTAAGGCTTTCAGCAAAATTGG + Intergenic
1100979270 12:100152067-100152089 ACAAAGGCTTTGTGTACAAAAGG - Intergenic
1109076499 13:57843181-57843203 CTAGAAGTTTTCTTTACAATAGG + Intergenic
1111395630 13:87665194-87665216 TTAGTGGCTTTTTGTACAATTGG - Intergenic
1112160094 13:96858156-96858178 CTAAAGGCTATCAATACAATGGG + Intergenic
1116876583 14:50118370-50118392 GCAAAGGCAGTCTGTACAATGGG + Exonic
1117299505 14:54410505-54410527 CTATAGGCATTCTATACACTAGG - Intronic
1118083734 14:62392216-62392238 CTTAAGCATTTCTGTAGAATTGG + Intergenic
1118417843 14:65562770-65562792 CTAAAGGCTTTCTGTACAATTGG - Intronic
1119286553 14:73459309-73459331 CTAATGGCTGTCTGGTCAATTGG - Intronic
1121406871 14:93724498-93724520 CTTAAGGCTTTCTGGAAAAGGGG - Intronic
1122761940 14:104035133-104035155 ATAAAGGCTTTCTTTCCAAAAGG - Intronic
1123916724 15:25037957-25037979 GTAAAGCTCTTCTGTACAATAGG + Intergenic
1124359177 15:29022448-29022470 CTAAAGACTTATTGTAAAATAGG - Intronic
1124582584 15:30973117-30973139 CTAAAGTCCTTCTATATAATAGG + Intronic
1125281866 15:38050405-38050427 CTAAAGGGTTTCTAAATAATAGG + Intergenic
1125376320 15:39033607-39033629 CTGAAGGCTCACTGTAGAATAGG - Intergenic
1125777205 15:42226955-42226977 CCAAAGGCTTTATGAACAAGGGG - Intronic
1126891083 15:53204899-53204921 CTAAAGACTTTCAATACATTTGG + Intergenic
1127345734 15:58095946-58095968 CTAAAGGCATGCTATACAACAGG + Intronic
1129396012 15:75246961-75246983 CTAAAGGCTTTCTGCAGACAAGG + Intergenic
1129754493 15:78088900-78088922 ACAAAGGCTTTATGTACAAAAGG - Intronic
1133164774 16:3938861-3938883 CTGAAGGCGGTCTGTGCAATTGG + Intergenic
1133466909 16:6036119-6036141 CAAAACGCTTTGTGTACAATGGG + Intronic
1138836151 16:60437723-60437745 TTAAAGTATTTCTTTACAATAGG + Intergenic
1144317224 17:14073389-14073411 GTAATGGTTTTATGTACAATAGG + Intronic
1145353167 17:22107665-22107687 GTAAAGGCTGTCTGTAGACTTGG - Intergenic
1145890594 17:28412480-28412502 TAAAGGGCTTTCTGTACAGTGGG + Intergenic
1145986941 17:29053340-29053362 CAAAAGGCTTTCTGTCCACCAGG + Intronic
1149349047 17:55768883-55768905 CTAAAGGCTTTATGTGCCTTTGG - Intronic
1150180856 17:63119405-63119427 TTAAAGGCTTTCTAAACATTGGG - Intronic
1153632442 18:7084665-7084687 TTAAACCCTTTCTGTACACTTGG + Intronic
1155166196 18:23234389-23234411 CTTCAGGCTTTCTGTTCAGTTGG + Intronic
1155994508 18:32316100-32316122 CTGAAGTCTTCCTGTCCAATAGG - Intronic
1156552556 18:38033088-38033110 GAAAAGGCTTTCTGTAATATGGG + Intergenic
1157145793 18:45161044-45161066 CTAAAGCCTTTCTATTCAAAAGG - Intergenic
1157470976 18:47988549-47988571 TTAAATGCTTTCTGCAAAATGGG - Intergenic
1157895837 18:51466111-51466133 CTTAAGGATTACTGTCCAATTGG + Intergenic
1159293073 18:66446623-66446645 CAAAAGGCTATTTGTACAGTCGG - Intergenic
1163940593 19:20489758-20489780 CTAAAGATTTTCTGGAAAATGGG - Intergenic
1166588511 19:43973208-43973230 CTAAAAGCTCTCTGTAAACTAGG + Intronic
1166986933 19:46666309-46666331 CTAAAGGATTTCTGTGAAATGGG + Intergenic
925469433 2:4143102-4143124 CTTAAGACTTTCTTTACATTGGG + Intergenic
926313555 2:11693009-11693031 CTAGAGGCTTTCTCTAGACTTGG + Intronic
928214284 2:29348359-29348381 ATAAATGCTTTCTGTTCATTTGG + Intronic
929183937 2:39073814-39073836 CTAATGGCTTTCTGGAGAATTGG + Intronic
935663304 2:105488191-105488213 CTTAAGCCTTTCTTTACAAGTGG - Intergenic
937640703 2:124207709-124207731 CTAAAGGTTTTCTTCAAAATGGG + Intronic
940268719 2:151868078-151868100 ATAAAAGCTTTCTGGATAATTGG - Intronic
940617375 2:156066224-156066246 GTAAATGCTTTATGTACCATCGG + Intergenic
940625153 2:156166114-156166136 ATAAAGGCTTGCTGTATAGTAGG + Intergenic
942766705 2:179465910-179465932 CCTATGGCTTTCTGTACATTGGG - Intronic
943177767 2:184499482-184499504 CTAAAGCATATCTGTACTATGGG + Intergenic
943235529 2:185313759-185313781 CTAAAGTCTTTCTTTGCCATTGG + Intergenic
944643624 2:201754793-201754815 CTAGAGGCTCTCTGTAGAAAAGG + Intronic
944762459 2:202831129-202831151 CTAGAGGCTATCTGGAAAATTGG - Intronic
945436846 2:209828842-209828864 TCAAAGGCTTTGTGTGCAATGGG - Intronic
947751051 2:232532513-232532535 CCAAAGGCCATCTGTAGAATGGG + Intronic
1169585638 20:7081231-7081253 CTAAAGGCTTAATGTATGATTGG + Intergenic
1170001249 20:11617143-11617165 TTAAAGCCTTTCTGTTAAATTGG - Intergenic
1170011062 20:11724503-11724525 ATAAAGGCTATCTGAACAACAGG - Intergenic
1170998124 20:21385568-21385590 CTAAAGTTTTTCTTTACAGTTGG - Intronic
1176926693 21:14758673-14758695 TTAAACGCTTTCTGTCCAAAAGG + Intergenic
1176993552 21:15526849-15526871 ATAAAGGCTTTCTGTATCCTGGG - Intergenic
1180719427 22:17896345-17896367 CTACAGCCTTTCTGGCCAATGGG - Exonic
1183677981 22:39310470-39310492 AGAAAGGCTTTCTGTGCACTTGG + Intergenic
949432974 3:3998279-3998301 CCACAGGCATTCTATACAATGGG - Intronic
953673592 3:44982768-44982790 CATAAGGCTTTCTGTGCCATGGG - Intronic
955860337 3:63322891-63322913 CTAAGGGCTCTCTGTGCTATAGG + Intronic
956914355 3:73855416-73855438 CTAAAGGATATTTGTACATTTGG - Intergenic
960205239 3:114889141-114889163 CGAAAGGATTTCTGTGCATTAGG - Intronic
963873287 3:150443211-150443233 ATAAACCCTTTCTGTAAAATAGG + Intronic
964600164 3:158491524-158491546 GTTAAGGCTTTCGGTATAATTGG + Intronic
966564387 3:181360436-181360458 CTTAAGACTTTCTGTTCATTTGG - Intergenic
967989633 3:195121335-195121357 CCCAAGGCTTTCTGTACAAGAGG - Intronic
968673877 4:1866629-1866651 TTGGAGGCTGTCTGTACAATGGG - Intergenic
970636476 4:18015467-18015489 ATCAAGTCTTTCTGTAAAATAGG - Intronic
971303753 4:25462976-25462998 CTAAAGGTGTTCTGTACACCGGG - Intergenic
974796212 4:66753503-66753525 ATAAAGGCTTTTGATACAATTGG + Intergenic
977171163 4:93764300-93764322 CTAAAATTTTTCTGTTCAATGGG + Intronic
981062271 4:140437491-140437513 CTCAAGACTTTCAGTTCAATGGG + Intergenic
987924908 5:24328116-24328138 CAAAATGCTTTCTGCACAGTAGG + Intergenic
989792539 5:45423029-45423051 CTAAAAGCTTTGAGTACAATTGG + Intronic
991038968 5:62157009-62157031 CAAAGAGCTTTCAGTACAATAGG + Intergenic
991155714 5:63432468-63432490 CTAAAAGTTTTCTGGACTATGGG + Intergenic
992171894 5:74110194-74110216 CTAAAGGCTTACTGGACTGTGGG - Intergenic
992199344 5:74368492-74368514 CTAAAGACTTTTTTCACAATAGG + Intergenic
992549601 5:77848120-77848142 CTAAAGGCTTTCTGCAGGATAGG + Intronic
992668179 5:79032355-79032377 CTAAAGGTTTGCTGTACTTTAGG - Intronic
992770110 5:80039739-80039761 CTAAAGGCTTAAAGTACAAGGGG - Intronic
993373953 5:87127123-87127145 CTAAAGGCTTTCTGTCCTATAGG + Intergenic
994132832 5:96250230-96250252 CTAAAGGCTTTATATAAAAAAGG + Intergenic
994261350 5:97662547-97662569 TTAAATGCTTTCTTTAAAATGGG + Intergenic
995301613 5:110591133-110591155 ATAAAGGCTTTATGTAAAAATGG + Intronic
995933370 5:117479393-117479415 CTAAAGGCTTTGTTAACAAAGGG + Intergenic
999487335 5:152010547-152010569 CTAAAGGGTTTATGTATAATTGG + Intergenic
1001175025 5:169460423-169460445 CTAAGGGACTTCTGTTCAATTGG + Intergenic
1002804375 6:558354-558376 TTAAATGCTTTCTGTGCAGTTGG - Intronic
1007432441 6:41784567-41784589 CTAAAGGCTTACAATTCAATTGG + Intronic
1012320084 6:97832675-97832697 GTAATGGTTTCCTGTACAATAGG - Intergenic
1014562661 6:122910084-122910106 TTAAATGTTTTCTGTAGAATGGG + Intergenic
1016843290 6:148545171-148545193 CTAAATGTTTTTGGTACAATGGG - Intronic
1017920505 6:158868396-158868418 CTAGACCCTTTCTGTAAAATGGG + Intergenic
1022394767 7:29977093-29977115 GTCAAGGCTTTCTTTTCAATGGG - Intronic
1025592888 7:62885290-62885312 CTAGAGGCTTATTGTAAAATAGG + Intergenic
1027846339 7:83381378-83381400 ATAAAAACTTTCTGGACAATGGG - Intronic
1028485336 7:91351223-91351245 CTAAATGCTTTATGTGTAATAGG + Intergenic
1032308299 7:130757198-130757220 TTAAAGTCTTTCTGTGTAATTGG + Intergenic
1032655928 7:133929519-133929541 GTAAATGCTTTGTGTAAAATTGG - Intronic
1038305956 8:26402465-26402487 CTTAAAGCTTTCTGTATAAAAGG - Intronic
1041158817 8:55016655-55016677 CTAAAGGCTTTCAAAACACTGGG + Intergenic
1041969726 8:63725717-63725739 GTAAAAGCTTTATGTACATTTGG - Intergenic
1044252121 8:90015880-90015902 CTGAGCCCTTTCTGTACAATAGG + Intronic
1044824878 8:96186223-96186245 CTAATGGCTTTCTGTTTAAGAGG - Intergenic
1044860064 8:96514571-96514593 CTAGAGTCCTTCTGTACATTAGG - Intronic
1046344473 8:112904457-112904479 CTAAAGGCTTTATGACCTATAGG - Intronic
1046544093 8:115625438-115625460 CTATAGTCTTTCAGTGCAATTGG - Intronic
1048434814 8:134406342-134406364 CTAAAGGCCTAATGTACAACAGG - Intergenic
1048799124 8:138180065-138180087 CTAAAGCATTTCTGTCCAAAGGG - Intronic
1050085452 9:1960298-1960320 GTAAAGGGTTTCTGAACAGTGGG - Intergenic
1050814695 9:9795306-9795328 CTAAAAACTTTCCCTACAATGGG - Intronic
1055831575 9:80385552-80385574 CAGAAGGCTTTCTGCAGAATTGG - Intergenic
1197415647 X:126168610-126168632 CTAAATACTTTATGTACATTTGG + Intergenic
1198570246 X:137947235-137947257 TTGAATGCTTTCTCTACAATGGG + Intergenic
1201055770 Y:9989178-9989200 CAAAAGACTTACCGTACAATGGG + Intergenic