ID: 1118424708

View in Genome Browser
Species Human (GRCh38)
Location 14:65647938-65647960
Sequence GCTCCCTAAGCAAAACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118424708_1118424709 1 Left 1118424708 14:65647938-65647960 CCTTGGGGTTTTGCTTAGGGAGC 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1118424709 14:65647962-65647984 TATATTTCTGCCCACTTTGTTGG 0: 1
1: 0
2: 2
3: 24
4: 388
1118424708_1118424710 4 Left 1118424708 14:65647938-65647960 CCTTGGGGTTTTGCTTAGGGAGC 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1118424710 14:65647965-65647987 ATTTCTGCCCACTTTGTTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118424708 Original CRISPR GCTCCCTAAGCAAAACCCCA AGG (reversed) Intronic
900404237 1:2485512-2485534 GGTCCCTAAGCAGCACCCCCAGG - Intronic
900404247 1:2485554-2485576 GGTCCCTAAGCAGCACCCCCAGG - Intronic
900404258 1:2485596-2485618 GGTCCCTAAGCAGCACCCCCAGG - Intronic
900404269 1:2485638-2485660 GGTCCCTAAGCAGCACCCCCAGG - Intronic
900404281 1:2485680-2485702 GGTCCCTAAGCAGCACCCCCAGG - Intronic
902878130 1:19353157-19353179 GCACCCTCAGCAAGGCCCCATGG - Intronic
906057633 1:42929169-42929191 GCCCCCCCAGCCAAACCCCAGGG - Intronic
906316260 1:44788054-44788076 GCTTCCAAAGCAAGGCCCCAAGG - Intergenic
907917545 1:58884820-58884842 GCTTCCTAAGCAGAACCCCAGGG - Intergenic
911003988 1:93199088-93199110 GCTCGTGAAGCAACACCCCAAGG - Intronic
911061969 1:93756736-93756758 GCTCCATAAGGAACACTCCAGGG + Intronic
911497512 1:98649920-98649942 GCTGGCAAAGCAACACCCCAAGG - Intergenic
917752570 1:178067003-178067025 ACTCCCTTTGCAAAATCCCAGGG - Intergenic
918526791 1:185473520-185473542 CCTCCCTAAGCAAACCCCCGTGG - Intergenic
921625533 1:217374112-217374134 GCTGGCAAAGCAACACCCCAAGG + Intergenic
924516444 1:244770097-244770119 CCTCGCTAAGCAGAACCTCAGGG + Intergenic
1065201307 10:23315989-23316011 GCTGGCAAAGCAACACCCCAAGG - Intronic
1069946651 10:71990997-71991019 GCTCTCTAAGCAGCATCCCAGGG + Intronic
1070664764 10:78335297-78335319 TCTCACTAGGCAAAACCTCATGG + Intergenic
1071053074 10:81474251-81474273 GCTGCTGAAGCAACACCCCAAGG + Intergenic
1072414260 10:95233644-95233666 CCTCCCTTAGCAATTCCCCATGG - Intergenic
1073251395 10:102121931-102121953 GCTCCCTCAGCAAAAACCTAAGG - Intergenic
1074205720 10:111281196-111281218 GCTCCCCAAGGAAGACCCCATGG + Intergenic
1075561591 10:123472556-123472578 ACACCCTAAGGAAATCCCCAAGG + Intergenic
1078007689 11:7544888-7544910 GCTCCAGAAGCAACACACCAGGG - Intronic
1078715749 11:13837516-13837538 GCTACCTGAGCCAAACCACAAGG - Intergenic
1087968307 11:104447402-104447424 GCTACCTAACCAAAACAGCATGG + Intergenic
1088105842 11:106205768-106205790 TCTCCCTAAACAAAACAACATGG - Intergenic
1088328681 11:108628322-108628344 GCTGGCTAAGTGAAACCCCAAGG - Intergenic
1093281157 12:17197920-17197942 GCTGTCTAAGGAAAGCCCCAGGG - Intergenic
1093830713 12:23754100-23754122 GCTTCCTAAACTAACCCCCAAGG + Intronic
1094675170 12:32612479-32612501 GCTGACAAAGCAACACCCCAAGG + Intronic
1098662935 12:73121834-73121856 GCACCCAAAGAAAAACTCCAGGG - Intergenic
1102634350 12:114309838-114309860 CCTCCCTATTTAAAACCCCAAGG - Intergenic
1103218504 12:119223235-119223257 GATCCCTAAACACAAACCCAAGG + Intergenic
1103507915 12:121453955-121453977 GCTCCCCAAGAAAGACCGCAAGG + Intronic
1105468753 13:20672607-20672629 GCTCCTTACCCAAAACCCCTGGG + Intronic
1106253357 13:28001003-28001025 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1106347653 13:28894548-28894570 GCTGCCACAGCAAAACACCACGG - Intronic
1108559200 13:51626785-51626807 GCTGGCAAAGCAACACCCCAAGG - Intronic
1111667886 13:91292891-91292913 GCTCCATAAACTAAAGCCCAGGG - Intergenic
1116565420 14:46438849-46438871 GCAGCCTAAACAAAACCCCAGGG + Intergenic
1118424708 14:65647938-65647960 GCTCCCTAAGCAAAACCCCAAGG - Intronic
1119985754 14:79135484-79135506 GCTTGCTAAGCAATACCCCAAGG + Intronic
1121718303 14:96091654-96091676 GCTCCCTGAGCAGAACTCCCTGG - Exonic
1123935009 15:25189856-25189878 GCTCCCTAAGGAAACCCTCGTGG - Intergenic
1123938345 15:25204799-25204821 GCTCCCTGAGGAAACCCACATGG - Intergenic
1123940002 15:25212226-25212248 GCTCCCTGAGGAAACCCTCATGG - Intergenic
1124392079 15:29268877-29268899 GGTCCATAATCAAGACCCCAAGG - Exonic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1131078251 15:89512772-89512794 GCTCCATAAACAGGACCCCAGGG - Intergenic
1132538633 16:496648-496670 GCTCACTCAGCAAAACAGCAAGG - Intronic
1132951227 16:2563513-2563535 CCTCCCTAGGCAAAATCCCAGGG - Intronic
1132963123 16:2636657-2636679 CCTCCCTAGGCAAAATCCCAGGG + Intergenic
1135717989 16:24789576-24789598 GCTCCATGGGAAAAACCCCATGG - Exonic
1135848901 16:25944450-25944472 AATGCCTAAGCAAAACCCCCTGG + Intronic
1137056763 16:35749782-35749804 GCTCCCTGAGCAGACCCACACGG - Intergenic
1137344007 16:47637510-47637532 GCTGGCAAAGCAACACCCCAAGG + Intronic
1138129661 16:54469088-54469110 GTTCCCCAAGCTAAACTCCAGGG + Intergenic
1138313220 16:56045955-56045977 GGTTCCTAAGCAAAGCCCAAAGG + Intergenic
1140551632 16:75872044-75872066 ACTCCCAAAGCAAAACCAGATGG + Intergenic
1140911843 16:79461479-79461501 GCTTCCTAGGCAATACTCCATGG - Intergenic
1142684868 17:1571937-1571959 CCTCACTGATCAAAACCCCAAGG + Intronic
1143261037 17:5598340-5598362 GCTCCCAAAGCAGCTCCCCAAGG - Intronic
1144553466 17:16261332-16261354 GCTGGCGAAGCAACACCCCAAGG + Intronic
1144722897 17:17484623-17484645 TCTCCCTCAGCCACACCCCAGGG + Intronic
1146087094 17:29839395-29839417 GCTGGCAAAGCAACACCCCAAGG + Intronic
1148655241 17:49278306-49278328 GCTCCCTAAGCAACTCCTCAGGG + Intergenic
1149693572 17:58598708-58598730 GCATCCTAAGCAGGACCCCAGGG - Intronic
1151553569 17:74835565-74835587 GCTCCCTCATCAGACCCCCAGGG - Intronic
1152530625 17:80916629-80916651 GCTGGCAAAGCAATACCCCAAGG + Intronic
1152864050 17:82711729-82711751 GCTGGCGAAGCAACACCCCAAGG - Intergenic
1153724135 18:7937625-7937647 GCTGGCGAAGCAACACCCCAAGG + Intronic
1157186572 18:45545531-45545553 GCTCCCACAGGAAAACCACAAGG + Intronic
1157581383 18:48776118-48776140 CCTGCCTCAGCAAAACCCCAGGG - Intronic
1160914365 19:1489792-1489814 GCACCTGAAGAAAAACCCCAAGG - Exonic
1163600954 19:18248649-18248671 GCTCCTTAGGCCACACCCCATGG - Intronic
1165119661 19:33551046-33551068 GCTCTCTTAGCAAAGCCACATGG + Intergenic
1166597473 19:44062697-44062719 GCTCCCTATGGAAAGCTCCAGGG - Intronic
1167248119 19:48386051-48386073 GTTCCCTAAGGGCAACCCCAGGG - Intronic
1167714868 19:51136711-51136733 GCTACCTATGGAAAAGCCCATGG + Intergenic
925974239 2:9130081-9130103 GGTTCCTAAACAAAACTCCAAGG - Intergenic
926147051 2:10402869-10402891 GCAGCCTGCGCAAAACCCCAGGG + Intronic
926274991 2:11396819-11396841 CCTCCCTCAGCACACCCCCATGG - Intergenic
926783674 2:16499197-16499219 TCCCCCTAAGCAGAACTCCAGGG + Intergenic
928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG + Intronic
931300670 2:60974955-60974977 GCTGGCGAAGCAACACCCCAAGG + Intronic
935451841 2:103218673-103218695 CCACTCTAAGCAAAACCTCAAGG + Intergenic
937163879 2:119794240-119794262 GCTGGCTAAGCAATATCCCACGG - Intronic
938158194 2:128959173-128959195 GCTGCCATAGCAAAGCCCCATGG - Intergenic
942403228 2:175625538-175625560 TCTTCCTAAGCAAATGCCCAGGG - Intergenic
947933428 2:233983271-233983293 GCTCCCTGAACCAACCCCCAGGG + Intronic
948916742 2:241038099-241038121 GCTCCCTGAGCAGAGCCCTATGG - Intronic
1169124376 20:3116395-3116417 GCTGCCCAAGAAAGACCCCAGGG + Intronic
1170178736 20:13503277-13503299 ACTCCCCAAGCATGACCCCATGG + Intronic
1172096313 20:32462220-32462242 GCTCCCTCACCAAAACCTCTAGG - Intronic
1175829362 20:61953639-61953661 ACTCCCCAAGCACAAGCCCAGGG + Intronic
1181496329 22:23289244-23289266 GCTACCTAAGCACAGCCACAAGG - Intronic
954713387 3:52515755-52515777 GTTCCATCAGCGAAACCCCAGGG + Intronic
955349075 3:58180651-58180673 GGTGCCTAAGCACATCCCCAAGG - Intergenic
956011871 3:64840656-64840678 ACTGCTTAAGCAAAACCACAGGG - Intergenic
957041420 3:75338294-75338316 GCTGCATAAGCAAAACCAGATGG - Intergenic
960050413 3:113233879-113233901 GCTCCCAAACCAAATCCCTAAGG + Intronic
968623363 4:1614626-1614648 GCTTCCTAGACAGAACCCCAGGG - Intergenic
971568200 4:28172670-28172692 GCTCCCTAACCATAAACACATGG - Intergenic
972708459 4:41569480-41569502 GCTCCCTTAGCATAACCCCTGGG - Intronic
975040719 4:69742608-69742630 GCTGGTGAAGCAAAACCCCAAGG - Intronic
988509679 5:31854817-31854839 GCTCACTTGTCAAAACCCCACGG - Intronic
989410536 5:41115185-41115207 GATCCCTAAGAAATACCACATGG - Intergenic
990867668 5:60398052-60398074 CCTCCCAAAGCAAAACCTCTTGG - Intronic
990878931 5:60518357-60518379 GCTGGCAAAGCAACACCCCAAGG + Intronic
992838760 5:80667404-80667426 GCTGGCGAAGCAACACCCCAAGG - Intronic
993703203 5:91142847-91142869 GCTGGCAAAGCGAAACCCCAAGG - Intronic
995386490 5:111595479-111595501 GCTGGCAAAGCAAGACCCCAAGG - Intergenic
1003385160 6:5660741-5660763 GCTGCCTAAGCAAAGCTCCCTGG + Intronic
1004503587 6:16229787-16229809 GCTCCCAGACCAAGACCCCAGGG - Intergenic
1005959683 6:30686449-30686471 GCTGCCTCAGCGATACCCCAGGG + Exonic
1006089928 6:31622251-31622273 GCTCCCTAATCATGCCCCCAGGG - Intronic
1011284013 6:85705248-85705270 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1015195852 6:130524066-130524088 GCTCCCTGAGCAGAGCCCCAGGG - Intergenic
1016641514 6:146354557-146354579 GATCCCTAAGAAAAGACCCAGGG - Intronic
1016757713 6:147704826-147704848 GCTCACTCAGCTAATCCCCAAGG - Intronic
1018055836 6:160051530-160051552 GCTCAGAAAGCAATACCCCAAGG - Intronic
1018156325 6:160988653-160988675 GCTCCCTCAGGAATACCACAAGG + Intergenic
1020474708 7:8581861-8581883 GCTAGCAAAGCAACACCCCAAGG - Intronic
1021959457 7:25857833-25857855 TCTCCCTAGGCACACCCCCAAGG + Intergenic
1028378750 7:90175699-90175721 GCTGGCAAAGCAACACCCCAAGG - Intronic
1031053029 7:116964502-116964524 GCTCCCCAACCCAAGCCCCAGGG - Intronic
1032858466 7:135857095-135857117 GCTGGCAAAGCAACACCCCAAGG - Intergenic
1034210254 7:149357233-149357255 GCTGGCAAAGCAACACCCCAGGG - Intergenic
1035737142 8:1897312-1897334 GATCCCTTAGCAAACCTCCATGG - Intronic
1036187909 8:6640724-6640746 CCTTTCTAAGCAAAACCACAAGG - Intronic
1038350552 8:26772297-26772319 GCTCCTTTAGCAAAAGCCCTTGG - Intronic
1038406160 8:27324580-27324602 GCTTCCTCAGCACAACTCCAGGG + Intronic
1040532043 8:48274109-48274131 GCTCCCTTAGGCAGACCCCAGGG - Intergenic
1040853976 8:51930003-51930025 GCACACTAAACAAAATCCCAGGG - Intergenic
1041274567 8:56143452-56143474 GCTGGCGAAGCAACACCCCAAGG + Intergenic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1050690982 9:8225551-8225573 GGTCCTCAAGCAAAACACCACGG + Intergenic
1056824795 9:89869568-89869590 GCTCAGTAAGACAAACCCCAGGG - Intergenic
1056970391 9:91196263-91196285 GCTCAGTAAGCATCACCCCAGGG - Intergenic
1057067619 9:92070564-92070586 GCTCCCTCACCAGAACCTCAGGG + Intronic
1057114378 9:92506789-92506811 TCTCCCTGAGCAAACCCACATGG - Intronic
1057381185 9:94568946-94568968 CCTCCTTATGCAACACCCCATGG + Intronic
1060730706 9:126035032-126035054 GCTCCCTAAGGAGACCCCCTTGG - Intergenic
1060886759 9:127160144-127160166 CCTCCCCAAGCCAAAGCCCACGG - Intronic
1191387890 X:60093384-60093406 GCTCCCTGAGTTAAACTCCATGG - Intergenic
1191503627 X:61642758-61642780 GCTCCCTGAGTTAAACTCCATGG - Intergenic
1196151078 X:112375193-112375215 GCTCCCTTAGCATAACCATATGG - Intergenic
1200870737 Y:8095315-8095337 GCTTCCTTAGGAAAACACCAAGG + Intergenic
1200889754 Y:8310989-8311011 GCTTCCTTAGGAAAACACCAAGG - Intergenic
1202244690 Y:22808086-22808108 GCTTCCTTAGGAAAACACCAAGG - Intergenic
1202397679 Y:24441832-24441854 GCTTCCTTAGGAAAACACCAAGG - Intergenic
1202473102 Y:25228255-25228277 GCTTCCTTAGGAAAACACCAAGG + Intergenic