ID: 1118425144

View in Genome Browser
Species Human (GRCh38)
Location 14:65652333-65652355
Sequence CAATATAAGAGGAAGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118425139_1118425144 17 Left 1118425139 14:65652293-65652315 CCTCTGCTAGGATGGCTGTGCGA 0: 1
1: 1
2: 2
3: 5
4: 72
Right 1118425144 14:65652333-65652355 CAATATAAGAGGAAGTTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 181
1118425138_1118425144 18 Left 1118425138 14:65652292-65652314 CCCTCTGCTAGGATGGCTGTGCG 0: 1
1: 1
2: 4
3: 4
4: 107
Right 1118425144 14:65652333-65652355 CAATATAAGAGGAAGTTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118425144 Original CRISPR CAATATAAGAGGAAGTTGGC TGG Intronic
901818096 1:11806248-11806270 CAGTAAAGGAGGAAGATGGCGGG + Exonic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
907167489 1:52427045-52427067 CTATATAACAGGAACATGGCAGG + Intronic
907535822 1:55155693-55155715 GAACGTAACAGGAAGTTGGCTGG - Intronic
907825997 1:58017502-58017524 CAATGTGAGAGGAAGATGACAGG - Intronic
908314043 1:62915374-62915396 AAGTAGGAGAGGAAGTTGGCTGG - Intergenic
909140567 1:71859271-71859293 CAACAGAAGAGGAAGTTCCCAGG - Intronic
909746311 1:79101933-79101955 CAATACAAGATGAAATTGGGTGG - Intergenic
910452315 1:87359840-87359862 TTATATAGGAGGAAGTTGGAGGG + Intergenic
910622011 1:89265841-89265863 CATTATAGAAGGAAGTTGACTGG - Intronic
915015940 1:152733519-152733541 CAAAATAAGAGGATTCTGGCAGG - Intergenic
915885493 1:159717038-159717060 GAATTCAGGAGGAAGTTGGCTGG - Intergenic
916512255 1:165482672-165482694 GAAAAGAAGAGGAAGTTGGGGGG + Intergenic
919138161 1:193536356-193536378 CATTATAAGTGGAATTTGCCTGG + Intergenic
920024033 1:202978896-202978918 CAAAATAAGGGGTAGTGGGCAGG - Intergenic
920438424 1:205962934-205962956 CAAAGTGAGAGGCAGTTGGCAGG - Intergenic
923056418 1:230429304-230429326 AAATCAAAGAGGAAGTTGGGTGG + Intergenic
1065025251 10:21534626-21534648 CCATCTAAGAGGGAGTTGGGGGG - Exonic
1066446285 10:35486715-35486737 AAAGAAGAGAGGAAGTTGGCTGG - Intronic
1067103523 10:43350198-43350220 GAAGATAAGAGGAAGATTGCAGG - Intergenic
1068929257 10:62572391-62572413 CAATATAACAGGTAGTTGACAGG + Intronic
1070232659 10:74586245-74586267 CAAGATCAGAGGAAGGTGGGAGG + Intronic
1073763273 10:106654157-106654179 GAATATAAGAGTAAAATGGCAGG + Intronic
1076929501 10:133520704-133520726 CAAAACAAGAGGAAGTTTCCAGG + Intronic
1078846207 11:15120483-15120505 AAAGATAACAGGAAGTTGCCAGG + Intronic
1082950623 11:58811394-58811416 CAATAAAAGAGGGAGTTGTACGG - Intergenic
1082998351 11:59270196-59270218 AAATATCAGTGGAAGGTGGCAGG + Intergenic
1087444357 11:98229145-98229167 CATTATAAAAGGAATTTGCCAGG - Intergenic
1091572716 12:1703437-1703459 CAATTTAAAAGAAATTTGGCTGG + Intronic
1092248320 12:6876346-6876368 AAATAGAACTGGAAGTTGGCTGG + Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1099157980 12:79203464-79203486 CAATATAAGAGGAATTCTGTTGG - Intronic
1099963166 12:89416356-89416378 CAATATAAGTGGAATTGGGAAGG + Intergenic
1101544952 12:105703829-105703851 GAATAGAAGAGGAAGATGGTGGG + Intergenic
1102283270 12:111635034-111635056 CAAAATAAGAAAAAGTTAGCTGG + Intergenic
1104190739 12:126479918-126479940 CAATTTAAGAGGAAGGGGGTCGG - Intergenic
1105414103 13:20193773-20193795 GAAAAGAGGAGGAAGTTGGCTGG - Intergenic
1105970398 13:25424418-25424440 CAATATAGGAGGAAGTTAATTGG + Intronic
1111045784 13:82811857-82811879 CATTTTATGTGGAAGTTGGCAGG - Intergenic
1112037398 13:95509381-95509403 CACTTTAACAGGAAATTGGCTGG + Intronic
1112376153 13:98843208-98843230 CAATATGTGAGAAAGTTGCCAGG - Intronic
1114309026 14:21449191-21449213 TAAAATAAAAGGAGGTTGGCTGG + Intronic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1115657525 14:35458308-35458330 CAATATAAAAAGATGTAGGCTGG - Intergenic
1118345202 14:64934802-64934824 CAATAGATGAGGACATTGGCAGG - Exonic
1118425144 14:65652333-65652355 CAATATAAGAGGAAGTTGGCTGG + Intronic
1120021830 14:79539623-79539645 CAATATAAGAGAAAGAGGGGAGG - Intronic
1120525368 14:85570879-85570901 AAAAATAAGGGGAATTTGGCCGG - Intronic
1120621087 14:86765575-86765597 CAATATAAAAGGAAATGGCCAGG - Intergenic
1120754356 14:88228190-88228212 CAATGCAAGAGGTAGTTGGGCGG - Intronic
1122038756 14:98967085-98967107 CAATTCCAGAGGACGTTGGCAGG + Intergenic
1124041368 15:26108438-26108460 AAATATAAGAGAATGTTGGTAGG + Intergenic
1126968031 15:54077665-54077687 CAATTTGAGAAGTAGTTGGCCGG - Intronic
1130709112 15:86261971-86261993 CAGAATAAGAGGAAGATTGCAGG - Intronic
1135557618 16:23450230-23450252 TAATATAATAGCAAATTGGCTGG - Intronic
1138857367 16:60710595-60710617 CAATTAAAGGGGAAGTTGTCAGG + Intergenic
1141049249 16:80745823-80745845 CAACATAAGTGGAAGGTCGCTGG - Intronic
1141336784 16:83163438-83163460 CACTACAAGAGGAGGTTAGCGGG - Intronic
1141901089 16:86991078-86991100 CACTAGAAGTGGAATTTGGCTGG - Intergenic
1141955512 16:87368644-87368666 CTTTATAAGAGGAAGTGTGCTGG + Intronic
1144683602 17:17211592-17211614 CCATCTGAGAGGAAGATGGCTGG - Intronic
1145050877 17:19659546-19659568 CAAAAAAAGAGAAAATTGGCTGG + Intronic
1145978480 17:28997870-28997892 GAACATAAGAGGAAGAAGGCTGG - Intronic
1147247710 17:39133016-39133038 CAAGATAAGAGGAGAGTGGCGGG - Intronic
1150955369 17:69852981-69853003 CAATATAAAAGAAACCTGGCCGG - Intergenic
1155770714 18:29694899-29694921 AAATATTAGAGGACATTGGCTGG + Intergenic
1157366115 18:47065685-47065707 TAATAAAAGTGAAAGTTGGCTGG + Intronic
1158367822 18:56758910-56758932 CAATATTACTGGAAGTTGGAGGG - Exonic
1158528114 18:58233568-58233590 CAATTTAAGATGACGTTGGGTGG + Intronic
1160073774 18:75652176-75652198 AGTTATAAGAGTAAGTTGGCGGG - Intergenic
1162097602 19:8320266-8320288 CAAAATAAGTGGAAGCTGGAGGG - Intronic
1162625332 19:11880408-11880430 CAAAAGACGAGGAAGTTAGCAGG - Intronic
1165593919 19:36995475-36995497 CACTACAAGAAGAGGTTGGCAGG - Intronic
1165870181 19:38966264-38966286 TAATTTAAGAGAATGTTGGCCGG - Intronic
1167392191 19:49202824-49202846 CAATAAAAAACAAAGTTGGCTGG - Intronic
925771324 2:7285430-7285452 GATGATAAGAGGAATTTGGCTGG + Intergenic
925968720 2:9091132-9091154 AAAAATAAGAGGACATTGGCCGG - Intergenic
928128589 2:28632809-28632831 CAGTATCTGAGCAAGTTGGCAGG + Intronic
928220703 2:29400676-29400698 CAATAAAAGCAGATGTTGGCTGG + Intronic
929380175 2:41340588-41340610 CAATAGATGAGCAAGTTGACTGG + Intergenic
930428175 2:51237966-51237988 AAATATAAGAAGAAATTGGTTGG - Intergenic
931745836 2:65291307-65291329 CAAAATAAGAGGAAGTAGTCTGG + Intergenic
932356677 2:71073268-71073290 CAAGATAAGGGAAAGTTGGAGGG - Intronic
933328586 2:80869244-80869266 CATTTTAAGAGGAAGTTAGAAGG + Intergenic
934915515 2:98298227-98298249 CTACATAACAGGGAGTTGGCAGG - Intronic
935580154 2:104749821-104749843 CAATTTAAGGGGAGGCTGGCTGG - Intergenic
936276812 2:111106101-111106123 AAAGAGAAGAGGAAGTGGGCTGG - Intronic
936659760 2:114529524-114529546 CAATAAAAGAGCAACATGGCTGG - Intronic
937163147 2:119784977-119784999 CAGTATAAGAGGAAGTTTAGAGG - Intronic
937649885 2:124307931-124307953 CAATATATGACAAAGCTGGCGGG + Intronic
938986952 2:136585647-136585669 CATTTTAAGAGGAATTAGGCCGG - Intergenic
940106845 2:150110404-150110426 CAATAGAACTGGAAGCTGGCTGG + Intergenic
941259621 2:163280459-163280481 CAAGATAACAGCAACTTGGCTGG - Intergenic
941374888 2:164715387-164715409 AAATATAAGAGGAAAATGGAGGG + Intronic
942842780 2:180382721-180382743 CAATATAGGATGAAGTAAGCAGG - Intergenic
944633817 2:201655167-201655189 CAACATTAGATGAAGTTTGCTGG - Intronic
945797877 2:214387092-214387114 AAATATAAAAGGAAGTTGAAGGG - Intronic
945912788 2:215668734-215668756 CGATATAAAAAGAAGTTGGAGGG + Intergenic
947202839 2:227630185-227630207 GAATATAAGAGGGATTTGGAGGG - Intronic
1168865760 20:1085063-1085085 TAATATCAGAGAAAGTTTGCTGG - Intergenic
1169203266 20:3725921-3725943 CAAGAGAAGATGAAGTTAGCAGG + Intergenic
1171110005 20:22472190-22472212 CCAAATTAGAAGAAGTTGGCAGG - Intergenic
1173433415 20:43011586-43011608 TAAAATGAGAGGAAGCTGGCAGG + Intronic
1173526280 20:43735317-43735339 AAAAAAAGGAGGAAGTTGGCCGG - Intergenic
1175545975 20:59778098-59778120 CCAGAGAAGAGGGAGTTGGCTGG - Intronic
1177892406 21:26822423-26822445 CCAAATAAATGGAAGTTGGCTGG - Intergenic
1178462663 21:32817115-32817137 CAAGGTAAGTGGAAGTTTGCTGG + Intergenic
1178532656 21:33388332-33388354 GATTATAAGAGGAAGTAGGCTGG + Intergenic
1183364015 22:37397740-37397762 CAATGTAAGAAGAAGTGGGCAGG - Intronic
1183602394 22:38847511-38847533 CAAAACAAGAGGAAGTAGGGGGG + Intergenic
1184116931 22:42427591-42427613 CCATACAAGAGGCAGTGGGCTGG + Intronic
949101856 3:155292-155314 AAATACAATATGAAGTTGGCAGG - Intergenic
953669580 3:44951459-44951481 AAATAGAAAAGGAAGTGGGCAGG - Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
956747935 3:72324221-72324243 CAAGGGAAGAGGAAGGTGGCAGG - Intergenic
958648038 3:96898731-96898753 TAAAATAACAGGAATTTGGCCGG + Intronic
962703767 3:138024012-138024034 CAATATAAGAGGTTCTTAGCTGG + Intronic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964362041 3:155908499-155908521 CAGTAGAAGAGGAAGTTGTTAGG + Intronic
966030623 3:175342736-175342758 AAACATAAAAGGAAGTTGGAAGG - Intronic
967264448 3:187677984-187678006 AAATATAAGAGAAAGATGACAGG - Intergenic
967759568 3:193208219-193208241 CAATATAAGAGCAAGATCACAGG - Intergenic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
971376708 4:26061650-26061672 AATTATTGGAGGAAGTTGGCGGG + Intergenic
972297570 4:37754784-37754806 AGATATAGGAAGAAGTTGGCTGG + Intergenic
972904522 4:43728510-43728532 CAATATAACAGGAATTTACCTGG - Intergenic
973602672 4:52557665-52557687 TGATATAAGGGGAAGTTGGCTGG - Intergenic
974569997 4:63632917-63632939 CAATATGAGATGAATTTGGAAGG + Intergenic
976025811 4:80687097-80687119 CAGTAGGAGAGAAAGTTGGCTGG - Intronic
976433786 4:84993563-84993585 GAATATAAGAAGAAATTGGTAGG + Intergenic
979147749 4:117266682-117266704 CAATAAAAGATAAAGTTGGGTGG - Intergenic
979323713 4:119354143-119354165 GAATAAAAGAGGTAGATGGCTGG + Intergenic
980166595 4:129235405-129235427 CAAGAAAAGAGAAATTTGGCAGG - Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
982675668 4:158372934-158372956 TAAAATAACAGGAACTTGGCCGG - Intronic
983241547 4:165238811-165238833 GAATAAAAGAGGTAGATGGCTGG + Exonic
984027484 4:174560457-174560479 CAATAAAAGAGCAGGTTCGCTGG - Intergenic
992749397 5:79848544-79848566 CAAGACCAGAGGAAGTTGGCAGG + Intergenic
993474348 5:88345966-88345988 AAATATAAGAGGATTTTGGAAGG - Intergenic
993705479 5:91165011-91165033 CAATATAAGACGAAGGGGGTAGG - Intergenic
996242051 5:121215856-121215878 CAGTAGAAGAGGAGATTGGCCGG + Intergenic
997179306 5:131811893-131811915 TACTTTAAGAAGAAGTTGGCCGG - Intronic
997547265 5:134719393-134719415 AAAAAAAAGAAGAAGTTGGCTGG + Intronic
998127039 5:139631298-139631320 CAATATAAAAGAAAATAGGCTGG - Intergenic
1000396875 5:160785066-160785088 AAATGTGAGAGGAAGTTTGCTGG + Intronic
1000727470 5:164789933-164789955 AAATATAATAGAAAGTTGCCAGG + Intergenic
1004276209 6:14237372-14237394 AAATATTTGAGGAAGTTTGCAGG - Intergenic
1005904179 6:30246487-30246509 CAATATAAGAAAAAATAGGCTGG - Intergenic
1008228434 6:48952580-48952602 AAAAAGAAGAGGAAGATGGCAGG + Intergenic
1008975556 6:57421693-57421715 CAACATAAGAGGAAGTGGGATGG - Intronic
1012046027 6:94274384-94274406 CAATATAGCAGGAAGTTGATTGG + Intergenic
1012519717 6:100106398-100106420 CAATAAAGGAGGTAGTTGGGGGG + Intergenic
1017752701 6:157503202-157503224 CAATCAGAGAGGAAGGTGGCCGG - Intronic
1018644841 6:165938456-165938478 CAATAAAACAAGAATTTGGCTGG + Intronic
1019838276 7:3413042-3413064 CAATATAATTGTAACTTGGCAGG + Intronic
1020078343 7:5273390-5273412 CAAAAAAAGAGGTAGATGGCGGG - Intergenic
1020333191 7:7040941-7040963 CAATATAGGTTGAAGGTGGCAGG - Intergenic
1021399787 7:20196474-20196496 CAATAAAACTGAAAGTTGGCTGG - Intronic
1022313431 7:29219778-29219800 AATGATAAAAGGAAGTTGGCTGG + Intronic
1023492309 7:40756934-40756956 CAAAATGAGAGAAAGTTGGCAGG + Intronic
1026897013 7:74015127-74015149 AAATAAAAAAGGAAGTTGGTGGG - Intergenic
1028713965 7:93942635-93942657 CAATGTAACACAAAGTTGGCAGG - Intergenic
1029129165 7:98317147-98317169 CAGTTTAAGAGGAGGTTAGCCGG - Intronic
1030678887 7:112413397-112413419 AAATATAAGAGCAAGTGTGCCGG + Intergenic
1030930898 7:115522151-115522173 AAATATAAGGGGAAGCTGCCAGG + Intergenic
1036727610 8:11233425-11233447 GAATAAAGGTGGAAGTTGGCCGG - Intergenic
1037570295 8:20152216-20152238 AAATATAAGAGGAAAGTGGAGGG + Intronic
1037616430 8:20523138-20523160 CAATAAAATAGGAATTTGGATGG + Intergenic
1038386710 8:27155190-27155212 TAATATAAGATGAGCTTGGCAGG - Intergenic
1038542070 8:28398256-28398278 CAGTATAAGAGGGAGAAGGCTGG - Intronic
1043449636 8:80353571-80353593 CAAAATAAGATGAAATGGGCCGG - Intergenic
1043811271 8:84744128-84744150 AAAAATAAGAGGAAATGGGCAGG + Intronic
1045399799 8:101801964-101801986 CACAATAAGAGGAAGTATGCTGG - Intronic
1052848335 9:33357839-33357861 AAATATAAGTGGAAATGGGCTGG - Intronic
1053049502 9:34947810-34947832 AAAAATAAGAAAAAGTTGGCTGG + Intergenic
1053265791 9:36712381-36712403 GAATAGAAGAGGAGGTGGGCTGG - Intergenic
1054952820 9:70872238-70872260 CAATAAAACAGGTAGTAGGCTGG + Intronic
1057011358 9:91604779-91604801 CAATATAAGATGCAGTTGGTTGG + Intronic
1058105843 9:100971023-100971045 AAAGAAAAGAGGAAATTGGCAGG - Intergenic
1186441444 X:9590271-9590293 CAACATAAGTGGAAGCTGGGTGG + Intronic
1186622906 X:11260330-11260352 CATTAGAAAAGGAAGTTGGTGGG + Intronic
1186885381 X:13908033-13908055 CAATATAAGAGTGAGATGGGAGG - Intronic
1187514950 X:19960580-19960602 CTATATAACAGCAAGGTGGCAGG + Intronic
1193925550 X:87479362-87479384 CAATATAAAAACAAATTGGCCGG - Intergenic
1193999631 X:88412095-88412117 CAAGATATGAGGACATTGGCAGG - Intergenic
1194697641 X:97074576-97074598 CCATTTAAGAAAAAGTTGGCAGG + Intronic
1195890642 X:109689699-109689721 CAATTTTAAAAGAAGTTGGCTGG - Intronic
1196086303 X:111685939-111685961 TAATAGAAGATGAAGTTGGGTGG + Intronic
1196262791 X:113604355-113604377 TAATATAAAGGGAAATTGGCGGG + Intergenic
1196485394 X:116201172-116201194 CAAAATAATAAGAAGATGGCAGG - Intergenic
1197321139 X:125032464-125032486 GAATATAAGATGAATTTGGCTGG - Intergenic
1198642204 X:138768820-138768842 CAAAATAAAACGAAGTAGGCTGG - Intronic