ID: 1118425460

View in Genome Browser
Species Human (GRCh38)
Location 14:65655706-65655728
Sequence CTTCCATCAATTATTGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 1, 2: 14, 3: 156, 4: 562}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118425460_1118425464 22 Left 1118425460 14:65655706-65655728 CCTCTTTCAATAATTGATGGAAG 0: 1
1: 1
2: 14
3: 156
4: 562
Right 1118425464 14:65655751-65655773 GTCATTCATCATGACCAAGTGGG 0: 22
1: 252
2: 517
3: 912
4: 2130
1118425460_1118425463 21 Left 1118425460 14:65655706-65655728 CCTCTTTCAATAATTGATGGAAG 0: 1
1: 1
2: 14
3: 156
4: 562
Right 1118425463 14:65655750-65655772 GGTCATTCATCATGACCAAGTGG 0: 16
1: 227
2: 516
3: 818
4: 1663
1118425460_1118425461 0 Left 1118425460 14:65655706-65655728 CCTCTTTCAATAATTGATGGAAG 0: 1
1: 1
2: 14
3: 156
4: 562
Right 1118425461 14:65655729-65655751 CATTAGACCGAAAACAAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118425460 Original CRISPR CTTCCATCAATTATTGAAAG AGG (reversed) Intronic
900708918 1:4098676-4098698 GTTCCACCAATTATTGAGAAAGG + Intergenic
900842004 1:5058949-5058971 ATTCCATTCATTATTGAAAGTGG - Intergenic
903290168 1:22306645-22306667 GTCCTATCAATTCTTGAAAGAGG - Intergenic
904445214 1:30567727-30567749 CTTCCATGAACTACTGAAAATGG + Intergenic
904448154 1:30591281-30591303 GTTCAATCTGTTATTGAAAGTGG - Intergenic
904928576 1:34067862-34067884 CTTGCATCACATATTGTAAGTGG - Intronic
905041132 1:34959542-34959564 GTTCTATCAATTACTGAGAGAGG - Intergenic
905327426 1:37165795-37165817 GTTCCATTCATTATTGAAAGTGG + Intergenic
905501168 1:38438533-38438555 GTTCTATTAATTATTGAAAGAGG + Intergenic
905859269 1:41337577-41337599 GTTCTATCAATTATTGAGAGAGG + Intergenic
906230608 1:44159952-44159974 GTTCTATCCATTATTGAGAGTGG + Intergenic
906356819 1:45114547-45114569 TTTCTATCAATTATTGAAAAAGG - Intronic
907060770 1:51421999-51422021 ATTTCATAAATAATTGAAAGAGG - Intronic
907154130 1:52316763-52316785 CTTCCTTCAATTAGTGACACAGG - Intronic
907209389 1:52806390-52806412 GTTCTATCAATTATTGACAAAGG + Intronic
908883086 1:68755264-68755286 GTTCTATCAATTATTGAGAAAGG - Intergenic
909312615 1:74172646-74172668 GATCTATCAATTGTTGAAAGTGG + Intronic
909536610 1:76743565-76743587 ATTCTATCCATTATTGAAAGTGG + Intergenic
909671689 1:78196320-78196342 GTTTTATCAATTATTGAGAGAGG + Intergenic
910073910 1:83253665-83253687 ATGCTATCAATTATTGAAAAAGG + Intergenic
910394963 1:86783206-86783228 ATTTAATCCATTATTGAAAGTGG - Intergenic
911557716 1:99365276-99365298 CTTCCATCAGTTTTTGCACGTGG - Intergenic
911557752 1:99365954-99365976 ATACAATCAATTATTGAAAAGGG - Intergenic
911821815 1:102433611-102433633 GTTCTATTCATTATTGAAAGTGG - Intergenic
911939658 1:104025915-104025937 GTTCTATCCATTATTGAAAGTGG - Intergenic
911953107 1:104201686-104201708 ATTTCATCAATTATTGAGAGTGG - Intergenic
912663624 1:111558819-111558841 ATTCTATCAGTTACTGAAAGAGG - Intronic
912981963 1:114382657-114382679 GTTCTATCCATTATTGAAAGTGG + Intergenic
913036038 1:114967249-114967271 CTTCTATCTAATATTGACAGTGG + Intronic
913037821 1:114989923-114989945 GTTCTATTCATTATTGAAAGTGG - Intronic
914407636 1:147392031-147392053 ATTCTATCCATTATTGACAGTGG + Intergenic
915639306 1:157210111-157210133 CTGCTATCAACTATTGCAAGTGG - Intergenic
915804937 1:158837280-158837302 GTTCTACCTATTATTGAAAGTGG + Intronic
916006778 1:160669092-160669114 GTTCAATCCATTATTGAAAATGG + Intergenic
916267880 1:162909571-162909593 GTTCTATCCGTTATTGAAAGTGG + Intergenic
916300909 1:163273307-163273329 ATTCTATCAATTATTAAGAGTGG + Intronic
916617923 1:166462662-166462684 GTTCTATTTATTATTGAAAGTGG + Intergenic
917288604 1:173448185-173448207 CTTCTATCAATTACTGTGAGAGG - Intergenic
917466624 1:175283434-175283456 GTTCAATCAATTATTGAAAAAGG - Intergenic
917903117 1:179563396-179563418 GTTCCATCCATTGTTTAAAGTGG - Intronic
918090068 1:181283416-181283438 CTTCTATCAATTACTAAGAGAGG + Intergenic
918269312 1:182881314-182881336 CTTTCATCAATGAAGGAAAGCGG + Exonic
918398196 1:184137321-184137343 GTTCTATCAATTATTGAGAGTGG + Intergenic
918735148 1:188052280-188052302 GTTCTATTGATTATTGAAAGTGG + Intergenic
919168384 1:193924262-193924284 CTTCTATCAGTTACTGAAAGAGG - Intergenic
919515978 1:198523736-198523758 CTTTCATAAAATATTGAAACTGG + Intronic
919546361 1:198924615-198924637 CTTCCAACATTTTTTGAAATGGG - Intergenic
920121245 1:203660316-203660338 GTTCCTTCAGTTGTTGAAAGAGG + Intronic
920246902 1:204594807-204594829 GTTCTATCAACTATTGAGAGAGG + Intergenic
920883896 1:209907202-209907224 GTTCTATTCATTATTGAAAGTGG + Intergenic
921140941 1:212305615-212305637 GTTCTATCCATTATTGAAAGTGG + Intronic
921211534 1:212903556-212903578 GTTCTATCAATTGTTGCAAGTGG - Intergenic
921388305 1:214593506-214593528 GCTCTATCAATTACTGAAAGAGG - Intergenic
922010473 1:221579421-221579443 GTTCAAACAATTATTGAGAGAGG - Intergenic
922027788 1:221767972-221767994 ATTCTATCAATTACTGAGAGTGG + Intergenic
922401460 1:225261724-225261746 ATTCTACCAATTATTTAAAGGGG - Intronic
922714773 1:227862453-227862475 ATTTTATCCATTATTGAAAGTGG - Intergenic
922805568 1:228386585-228386607 GTTCTATTCATTATTGAAAGTGG - Intergenic
923264340 1:232299454-232299476 ATTAAATCAGTTATTGAAAGAGG - Intergenic
923968542 1:239172797-239172819 GTTCCATCAATTATTGATAATGG + Intergenic
924785526 1:247194649-247194671 TTTCTATTCATTATTGAAAGTGG - Intergenic
1062990907 10:1816051-1816073 GCTCCAGCAATTACTGAAAGTGG + Intergenic
1063431519 10:5994111-5994133 GTTCTATCAATTACTGAGAGAGG - Intergenic
1063835867 10:10011013-10011035 GTTCTACCAATTGTTGAAAGAGG - Intergenic
1063849654 10:10172316-10172338 ATTCTATCAAATATTGAGAGTGG + Intergenic
1064127745 10:12678558-12678580 GTTCCATCCATTATTGAAAGTGG + Intronic
1064636160 10:17369628-17369650 GTTCTATCCACTATTGAAAGTGG + Intronic
1065405519 10:25359033-25359055 ATTCTATCCATTATTGAGAGGGG + Intronic
1065422327 10:25559031-25559053 GTTCCATCAGTTATTGAGAGAGG + Intronic
1065477088 10:26151246-26151268 GTTCTATCAATTACTGAGAGAGG + Intronic
1066419887 10:35255185-35255207 GTTCTATCCATTATTGACAGTGG + Intronic
1067200220 10:44163369-44163391 TTTGTATCCATTATTGAAAGTGG + Intergenic
1067253699 10:44613455-44613477 GTTCTATACATTATTGAAAGTGG - Intergenic
1067366605 10:45636829-45636851 GTTCCATCGATTTTTGAGAGTGG + Intronic
1067632894 10:47979235-47979257 GTTCTATCCATTGTTGAAAGTGG - Intergenic
1067707206 10:48616444-48616466 CTTTCATCAAATTTGGAAAGTGG - Intronic
1068039587 10:51807243-51807265 TTTTTATCAATTTTTGAAAGAGG - Intronic
1068141387 10:53012410-53012432 CTTTCAACAGTTTTTGAAAGTGG + Intergenic
1068197251 10:53732738-53732760 GTTCTAACAATTATTGAAATAGG - Intergenic
1068286304 10:54940605-54940627 GTTCCATCTACTGTTGAAAGTGG + Intronic
1068388862 10:56366025-56366047 GTTCTATAAATTATTGTAAGTGG - Intergenic
1068425557 10:56858653-56858675 TTTTCATCAATTATTGAAAAAGG - Intergenic
1070099805 10:73374202-73374224 CTTCTATCCATTATTGAGAATGG - Intergenic
1070316276 10:75316140-75316162 GTTCTATCCATTGTTGAAAGTGG - Intergenic
1070936499 10:80301908-80301930 GTTCTATCCATTATTGAAAATGG - Intergenic
1071022598 10:81076213-81076235 ATTCTATCCATTATTGAGAGTGG + Intergenic
1071224047 10:83506292-83506314 CTTCTATCAATTACTGAGAAAGG - Intergenic
1071461965 10:85906322-85906344 TTTCTATCAATTATTTAGAGAGG - Intronic
1071544677 10:86520859-86520881 CTTCCATTAAAGATGGAAAGCGG + Intronic
1071582488 10:86785689-86785711 GTTCTGTCCATTATTGAAAGTGG + Intronic
1071692381 10:87835299-87835321 CTTCCATCCATCACTGAGAGAGG + Intronic
1071744195 10:88397034-88397056 GTTCTATCCATTATTGAAAGTGG - Intronic
1071768508 10:88697820-88697842 CTTCAATCAACTATCAAAAGAGG + Intergenic
1071811657 10:89188613-89188635 GTTCTCTCAATTATTGAAAGTGG - Intergenic
1072515499 10:96178042-96178064 GTTCTATCAATTACTGAGAGAGG - Intronic
1072785764 10:98280236-98280258 GTTCTATCAATTATTAAAAGAGG + Intergenic
1072867152 10:99075597-99075619 GTTCTATTGATTATTGAAAGTGG + Intronic
1073643817 10:105279078-105279100 CTTACAGCAATTGTTGAAAATGG - Intergenic
1074192076 10:111146786-111146808 CTTCCTTCTATTATGGAAGGTGG + Intergenic
1074409061 10:113209209-113209231 CATCTATCCATTATTAAAAGTGG - Intergenic
1074688753 10:115983368-115983390 CTTCTAACAATTATTGAGAGAGG - Intergenic
1075224650 10:120616798-120616820 GTTCTATAAATTATTTAAAGAGG - Intergenic
1075938585 10:126366991-126367013 TTTCTATCAATTATTGGGAGAGG - Intronic
1076376397 10:129990242-129990264 ATTCCATCAATTGTTGAGAGTGG - Intergenic
1078029373 11:7734199-7734221 ATTCTATCCATTATTGAAGGTGG - Intergenic
1078633048 11:13022324-13022346 GTTCTATCTGTTATTGAAAGTGG + Intergenic
1078896811 11:15604111-15604133 ATTCCCTCAAATGTTGAAAGAGG + Intergenic
1079863620 11:25706893-25706915 CATCCATCAGTTATTGAATGAGG - Intergenic
1081063914 11:38515501-38515523 GTTCTATCCATTATTGAGAGTGG + Intergenic
1081232997 11:40608994-40609016 GTTCTATCAATTACTGAAAGCGG - Intronic
1081728437 11:45350547-45350569 GTCCCATTAATTATTGAGAGAGG + Intergenic
1082618101 11:55386999-55387021 CTTGCATCATTTATAGAACGAGG - Intergenic
1084136728 11:67188987-67189009 GTTCTATCCATTATTGAGAGGGG - Intronic
1084152717 11:67298526-67298548 GTTCTATCCCTTATTGAAAGTGG + Intronic
1084292954 11:68187706-68187728 GTTCTATCCATTATTAAAAGTGG + Intronic
1084313331 11:68329496-68329518 CTTCCATCAATAAAAGAAATCGG + Intronic
1084794404 11:71495591-71495613 GTTCTGTCCATTATTGAAAGTGG + Intronic
1084830125 11:71762425-71762447 CTTCCATCCATCTGTGAAAGGGG - Intergenic
1084986397 11:72876736-72876758 GTTCTATCAATTACTGAAAGAGG + Intronic
1085268565 11:75254138-75254160 GTTCCATCAATTACTGAGGGAGG + Intergenic
1085473717 11:76774709-76774731 GTTCTATCCATTATTGAGAGTGG + Intergenic
1086036275 11:82418526-82418548 CTTCCCTCAATTATTTACTGTGG - Intergenic
1086117200 11:83265365-83265387 CTTCCATAAAGATTTGAAAGAGG - Intronic
1086739321 11:90347689-90347711 GATCTGTCAATTATTGAAAGAGG + Intergenic
1086739337 11:90347962-90347984 GATCTGTCAATTATTGAAAGAGG + Intergenic
1087452168 11:98338426-98338448 GTTCTATCCATTATTGAAAGTGG + Intergenic
1087688251 11:101289663-101289685 GTTCCATCCATTATCGAAAGTGG + Intergenic
1087808830 11:102587518-102587540 GTTCTATCCATTACTGAAAGTGG + Intronic
1087905452 11:103691297-103691319 ATTCTATCCATTATTGAAAATGG + Intergenic
1087970903 11:104482032-104482054 CTTCCACCAAACATTTAAAGGGG + Intergenic
1087980458 11:104606824-104606846 TTTCTATCAATTATTGAGAGTGG + Intergenic
1087983160 11:104642698-104642720 CTTCCATTAATATTTAAAAGTGG - Intergenic
1088205341 11:107386373-107386395 CATCCATCAATTATATAAGGAGG - Intronic
1089875671 11:121719429-121719451 ATTCCATGCCTTATTGAAAGAGG - Intergenic
1089888186 11:121850822-121850844 GTTCTATCAATTACTGAGAGAGG + Intergenic
1090496567 11:127218461-127218483 TTTCATTCACTTATTGAAAGGGG - Intergenic
1090505175 11:127304162-127304184 CTTACATTAAATATTGAAGGAGG + Intergenic
1090525874 11:127536011-127536033 GTTCTATTCATTATTGAAAGTGG + Intergenic
1090577379 11:128120720-128120742 GTTCTATGCATTATTGAAAGTGG - Intergenic
1090742037 11:129672356-129672378 GTTATATCAATTATTGAAAGAGG - Intergenic
1090822713 11:130358179-130358201 ATTCTATCCATTATTGAAAGTGG + Intergenic
1091106805 11:132928538-132928560 GTTATATCTATTATTGAAAGTGG - Intronic
1091269526 11:134296988-134297010 ATTCCATCAATTTTTGTGAGAGG + Intronic
1091328196 11:134708123-134708145 GTTCTGTCAATTATTAAAAGGGG - Intergenic
1091412066 12:248701-248723 ATTCTATAAATTATTGAGAGAGG - Intronic
1091576975 12:1746687-1746709 GTTCTACCCATTATTGAAAGTGG - Intronic
1092820706 12:12350716-12350738 CATCCTCCAATTATGGAAAGAGG - Intergenic
1093046475 12:14451928-14451950 GTTCTATCCATTATTGAAAGTGG + Intronic
1093395307 12:18673763-18673785 CTTCCAACAGCTACTGAAAGAGG - Intergenic
1093535154 12:20214391-20214413 CTCCCTTCAATTATTGTTAGAGG - Intergenic
1093826517 12:23697142-23697164 GTTCAATCAATAATTGAAAGAGG + Intronic
1093986131 12:25536150-25536172 GTTGTATCAATTATTGAGAGAGG - Intronic
1094274048 12:28648437-28648459 CTTCCAAGGATTTTTGAAAGTGG - Intergenic
1095526979 12:43138599-43138621 GTTCTATCCAGTATTGAAAGTGG - Intergenic
1095910472 12:47421047-47421069 GCTCCATCAATTGTTTAAAGAGG - Intergenic
1096733652 12:53635300-53635322 GTTCTATCCATTATTGAAAGTGG + Intronic
1096945667 12:55406327-55406349 GTTATATCCATTATTGAAAGTGG + Intergenic
1097889835 12:64766613-64766635 ACTCTATCCATTATTGAAAGTGG - Intergenic
1098586960 12:72165390-72165412 CTTTCAGCAATTATTGATATTGG + Intronic
1099768219 12:87018264-87018286 ATTCCATTCATTATTGAAAGTGG - Intergenic
1099845484 12:88023265-88023287 CCAGCATCATTTATTGAAAGGGG - Intronic
1100047517 12:90400726-90400748 GTTCCATCTATTATTAAAAGTGG - Intergenic
1101302109 12:103493654-103493676 CCTCCACCAATAATTTAAAGAGG - Intronic
1103235850 12:119371842-119371864 CCTACATCCATTATTAAAAGGGG + Intronic
1104166641 12:126237583-126237605 GTTCTATTAATTATTGAGAGAGG + Intergenic
1105382195 13:19897914-19897936 GTTCTATCAATTGTTGAAAGGGG - Intergenic
1105416210 13:20214060-20214082 TTTCTATCAGTTATTGAGAGAGG - Intergenic
1105733161 13:23240391-23240413 CTCCTATCAGTTATTGAGAGAGG - Intronic
1105856509 13:24377209-24377231 GTTCTATTCATTATTGAAAGTGG - Intergenic
1105958207 13:25303926-25303948 CTTGGATAAATTAATGAAAGAGG + Intronic
1106767572 13:32930084-32930106 GTTCTATCTATTACTGAAAGAGG + Intergenic
1106808393 13:33334762-33334784 CTTCCATCAGTTATTGGAAATGG - Intronic
1107128723 13:36872247-36872269 CTTCCTTTGATTGTTGAAAGAGG + Intronic
1107203654 13:37754080-37754102 CTTCCTTAAATTATTGAAACAGG - Intronic
1107383754 13:39885562-39885584 GTTCTATCCATTATTGAAATTGG - Intergenic
1107519552 13:41166018-41166040 GTTCTATCTATTATTGAAAGTGG + Intergenic
1107608607 13:42089182-42089204 GTTCTATCAGTTATTGAAAAAGG - Intronic
1107783543 13:43930966-43930988 CTTCTCTCAATAATTGAAAGTGG - Intergenic
1108136228 13:47365393-47365415 GTTCTATCCATTATTGAAAATGG + Intergenic
1108426152 13:50302805-50302827 GTTCCATCAAATATTGAGAAAGG - Intronic
1108930341 13:55810056-55810078 GTTCCATCAATTTTTGGAGGTGG - Intergenic
1109170437 13:59089571-59089593 TTTCCATAAATTATTTCAAGTGG - Intergenic
1109605027 13:64682459-64682481 GTTCTATTTATTATTGAAAGTGG + Intergenic
1109924958 13:69124672-69124694 GTTCCATCAATTGTTGAGAGAGG - Intergenic
1110435051 13:75469818-75469840 CTTGCCTCAATGATTGAAATTGG + Intronic
1110527041 13:76550352-76550374 CTTCCATCTATTAATGAACACGG - Intergenic
1110574283 13:77038182-77038204 CTTCCCTCAATTATTGAAGTGGG - Intergenic
1110585352 13:77184564-77184586 CCTCTATTAATTACTGAAAGAGG + Intronic
1111550091 13:89797468-89797490 CTTGTATCAATTATTGAGAGAGG + Intergenic
1112140762 13:96639103-96639125 GTTTTATCTATTATTGAAAGTGG + Intronic
1112858459 13:103800594-103800616 CATTCATCTATTGTTGAAAGAGG + Intergenic
1112953094 13:105026719-105026741 GTTCTATCCATTATTGAAATTGG + Intergenic
1114368881 14:22063080-22063102 CTTCTATTAGTTATTGAGAGTGG + Intergenic
1114924583 14:27379315-27379337 TTTCTATCCATTATTGAAAGTGG - Intergenic
1115117768 14:29903397-29903419 CTTCAATCAATTATTCATACAGG + Intronic
1115332167 14:32210091-32210113 CTTTCATCAGTTATTCAAAGAGG + Intergenic
1115360675 14:32497708-32497730 TTCCAATCAATTTTTGAAAGAGG + Intronic
1115470938 14:33767808-33767830 CTTTCCTCAAGTATTGACAGAGG + Intronic
1115570358 14:34660529-34660551 GTTCTATTAATCATTGAAAGAGG + Intergenic
1115670698 14:35608763-35608785 GTTCTGTCCATTATTGAAAGTGG - Intronic
1116234756 14:42264841-42264863 ATTCTATCCATTAATGAAAGTGG + Intergenic
1116493304 14:45531666-45531688 GTTCTGTCTATTATTGAAAGTGG + Intergenic
1116530930 14:45972557-45972579 CTTCCATCACTAATTAGAAGTGG + Intergenic
1117934888 14:60892222-60892244 TTTCTATCTATTATTGAGAGGGG + Intronic
1118425460 14:65655706-65655728 CTTCCATCAATTATTGAAAGAGG - Intronic
1118508107 14:66438289-66438311 CTCCCATCAATTATTAAGAGAGG + Intergenic
1118536232 14:66768696-66768718 GTTCTATCCATTATTGAAAGTGG - Intronic
1118545968 14:66889165-66889187 GTTCTATCCATTATTGAATGTGG - Intronic
1118703310 14:68456651-68456673 GTCCTATCCATTATTGAAAGTGG - Intronic
1119056389 14:71425769-71425791 GTTCCATCCATTATTGAGAATGG + Intronic
1119550464 14:75507814-75507836 ATTCCATCTATTAATGAAAGTGG - Intergenic
1119940567 14:78636755-78636777 ATTACATAAATTATTGTAAGTGG + Intronic
1120606558 14:86585316-86585338 GTTCCATCCATCACTGAAAGTGG - Intergenic
1120763358 14:88305933-88305955 CTTCCATCAGTTATTGGTTGAGG + Intronic
1121403016 14:93698296-93698318 ATTCTATCAATTATTGAGAAAGG + Intronic
1122311321 14:100797008-100797030 GTTCCATCAAGTTTTGAAAAAGG - Intergenic
1122527947 14:102402000-102402022 TTTCTATCCATTATTGATAGTGG - Intronic
1123953435 15:25308189-25308211 ATTCTATCCATTATTAAAAGTGG + Intergenic
1124057056 15:26251125-26251147 ATTCCAGCCATTATTGAGAGTGG + Intergenic
1124116516 15:26848390-26848412 CTTACCTCAATTATTGCAACTGG + Intronic
1124213036 15:27779333-27779355 GTTCCATCTATTATTGAAAATGG + Intronic
1124228976 15:27925156-27925178 GTTCTATCAGTTATTGAGAGTGG - Intronic
1124723129 15:32130246-32130268 CTGTCATGAATTATTGAGAGAGG + Intronic
1125078961 15:35654360-35654382 ATCATATCAATTATTGAAAGTGG - Intergenic
1125133106 15:36307668-36307690 GTTCTATCAATTGTTGAGAGAGG + Intergenic
1125136215 15:36346441-36346463 GTTCCATCAGTTACTGAGAGAGG - Intergenic
1125215255 15:37264795-37264817 CTTCTATCAATTATTGAAAGAGG - Intergenic
1125262325 15:37841138-37841160 TTTACATTTATTATTGAAAGTGG - Intergenic
1125285167 15:38084756-38084778 CTTGAATCAATTAATAAAAGAGG + Intergenic
1126282623 15:46973695-46973717 ATTCTATCAAGTATTTAAAGAGG + Intergenic
1126452912 15:48829304-48829326 GTTCTATCCATTATTGAAAGTGG + Intronic
1127172565 15:56318050-56318072 GTTCTATCCATTATTGAAACTGG + Intronic
1127228074 15:56955805-56955827 GATCTATCAATTATTGAAAGAGG + Intronic
1128139548 15:65289080-65289102 ATTCTATTCATTATTGAAAGTGG + Intronic
1128434661 15:67634513-67634535 GTACTATCAATTACTGAAAGAGG + Intronic
1128488352 15:68119739-68119761 GTTCTATCACTTATTGAGAGAGG + Intronic
1128539971 15:68520341-68520363 GTTCCATCAGTTACTGAAAGAGG + Intergenic
1128596348 15:68954587-68954609 TTTCTATCAATTGTTGAAAGAGG + Intronic
1128899389 15:71406552-71406574 GCTCCATTTATTATTGAAAGTGG + Intronic
1129128604 15:73469174-73469196 TTTCTATCAGTTATTGAGAGAGG + Intronic
1129577108 15:76761855-76761877 ATTCTATCCATTATTGAGAGTGG + Intronic
1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG + Intronic
1130721471 15:86390311-86390333 GTTCCATGAATTATTGAGAGTGG - Intronic
1130731930 15:86503995-86504017 GTTCTATCCATTACTGAAAGTGG + Intronic
1130732000 15:86505469-86505491 CTTCTCTCTATTCTTGAAAGTGG + Intronic
1131844952 15:96480927-96480949 GTTCTATCAATTATTGATAGTGG + Intergenic
1131903917 15:97119941-97119963 CATCTACCCATTATTGAAAGTGG - Intergenic
1131910332 15:97192367-97192389 CTTCTATTAATTATTGAGAGAGG + Intergenic
1132075360 15:98815527-98815549 CTTCCATAAATAATTGCAATAGG - Intronic
1132198234 15:99929833-99929855 GTTCTTTCCATTATTGAAAGTGG + Intergenic
1133948983 16:10373986-10374008 GTTCTATGCATTATTGAAAGTGG + Intronic
1135036570 16:19083246-19083268 CTTCCACCAATGGTGGAAAGAGG + Intergenic
1136481638 16:30545667-30545689 CTTGCATCAAATATTGGGAGTGG + Intronic
1137353981 16:47740349-47740371 GTTCTATCCATTATTGAAAATGG - Intergenic
1137899035 16:52245212-52245234 CATCCATCAGTTATTGAATAAGG + Intergenic
1138197679 16:55063876-55063898 CTTCTATCAATTATTGAGAGAGG - Intergenic
1138364850 16:56466666-56466688 CATCCATCTATTATTGAGAAGGG - Intronic
1138666340 16:58572316-58572338 GATCTATCTATTATTGAAAGTGG - Intronic
1138785570 16:59841696-59841718 GTTCTATCCATTACTGAAAGTGG + Intergenic
1138841937 16:60520643-60520665 CTAACATCATTTATTGAAAAGGG - Intergenic
1139031488 16:62887184-62887206 CTTCAGTCCATTATTGATAGAGG + Intergenic
1139094445 16:63687756-63687778 GCTCAATCAATTGTTGAAAGTGG - Intergenic
1139098776 16:63739223-63739245 ATTATATCAATTACTGAAAGAGG - Intergenic
1139406018 16:66718251-66718273 CTTCCATCCATCATGGCAAGGGG + Intergenic
1140152463 16:72383354-72383376 GTTCTATATATTATTGAAAGTGG - Intergenic
1141024465 16:80532018-80532040 TTTCTATCAATTGTTGACAGAGG + Intergenic
1141244299 16:82291858-82291880 GTTCCATTTATTAGTGAAAGGGG + Intergenic
1141783649 16:86182787-86182809 GTTCCATCAATTATTGGGATAGG - Intergenic
1142506647 17:368079-368101 ATTCTATCCATTATTGAAAGTGG + Intronic
1142911448 17:3096785-3096807 GTTCTATCCATTATTGAAAGTGG - Intergenic
1142924389 17:3221426-3221448 GTTCTATCCATTATTGAAAGTGG + Intergenic
1143035866 17:3997539-3997561 CTTCTATCCACTACTGAAAGTGG + Intergenic
1143741745 17:8959498-8959520 CTTTCATCAGTTTTTCAAAGGGG + Intronic
1143906399 17:10212529-10212551 CTTCCATACATTATTGTCAGAGG - Intergenic
1143931441 17:10432169-10432191 GTTACATCCATTATTGAAAGTGG + Intergenic
1145894812 17:28449181-28449203 GATCCATCAATTATTGAGAGAGG - Intergenic
1146463813 17:33069407-33069429 GTCCTATCAATTATTGAGAGAGG + Intronic
1146741986 17:35294348-35294370 CCACCATCATTTATTGAAAAGGG - Intergenic
1150114045 17:62529090-62529112 GTTCTATCAATTATTAAGAGCGG + Intronic
1150707982 17:67505283-67505305 GTTCTATCCATTATTCAAAGTGG + Intronic
1152548421 17:81015233-81015255 ATTCTCTCAATTACTGAAAGAGG - Intergenic
1152986563 18:326832-326854 TTTCCATCAGTAATTGAGAGGGG + Intronic
1153077296 18:1178569-1178591 TTTCTATCAATTATTGAAAATGG - Intergenic
1153258963 18:3202726-3202748 GTTCTATCAGTTATTGAGAGTGG - Intronic
1153264261 18:3253871-3253893 CTTCCCTAAATTTTTAAAAGGGG - Exonic
1153603325 18:6804949-6804971 GTTCTATAGATTATTGAAAGAGG + Intronic
1154003163 18:10503572-10503594 ATGCTATCCATTATTGAAAGTGG + Intergenic
1154076406 18:11206203-11206225 GTTCCATCACTTATTGAGAGTGG - Intergenic
1154973271 18:21431686-21431708 GTTCTATTCATTATTGAAAGTGG + Intronic
1155128803 18:22909038-22909060 ACCCTATCAATTATTGAAAGAGG + Intronic
1155577280 18:27261180-27261202 GTTCTATCCATTATTGAAATTGG + Intergenic
1155702596 18:28766365-28766387 TTTCCAACATTTATTTAAAGTGG - Intergenic
1156057323 18:33023150-33023172 GTCCTATCAATTATTGAGAGAGG - Intronic
1156082353 18:33352979-33353001 CTTTTATCCATTATTGGAAGTGG + Intronic
1156137035 18:34054273-34054295 GTTCTATCCATTATTAAAAGTGG + Intronic
1156170879 18:34483759-34483781 ATTCTATCAATTATTGAAAAAGG - Intergenic
1156428314 18:37041122-37041144 GTTCCAGCAAGTATTGAAAATGG + Intronic
1156430655 18:37070378-37070400 CTTCTATCAATTATTGACAGAGG + Intronic
1157778348 18:50415890-50415912 CGTCTATCAATTACTGATAGAGG + Intergenic
1157903720 18:51546126-51546148 CTTCTATCAATTACTGACAGAGG - Intergenic
1157917041 18:51674783-51674805 CCTCTATCAAAGATTGAAAGAGG - Intergenic
1158433044 18:57408925-57408947 GTTCTATCAATTACTGAGAGAGG - Intergenic
1159039855 18:63314115-63314137 ACTACATAAATTATTGAAAGGGG + Intronic
1159682524 18:71372544-71372566 CTTCCATCACACATTGCAAGGGG - Intergenic
1159706722 18:71698827-71698849 GTTATATCTATTATTGAAAGTGG - Intergenic
1159789113 18:72754742-72754764 GTTTTATCCATTATTGAAAGTGG - Intronic
1160087691 18:75793529-75793551 GTTCTATTAATTATTGAGAGAGG - Intergenic
1160180647 18:76632621-76632643 GTTCTATCCATTATTGAAAGGGG - Intergenic
1160498659 18:79391085-79391107 GTTGTATCCATTATTGAAAGTGG - Intergenic
1160562612 18:79768728-79768750 GTCTTATCAATTATTGAAAGAGG - Intergenic
1161747786 19:6071897-6071919 ATTCCATCAAGTTTTGAGAGGGG + Intronic
1161884872 19:6986707-6986729 CTTCTATCAATCATTGATAAAGG - Intergenic
1162174110 19:8817905-8817927 GTTTTATCCATTATTGAAAGTGG - Intronic
1162448694 19:10741178-10741200 TATCCATCCATGATTGAAAGTGG + Intronic
1162613322 19:11773522-11773544 GATCTGTCAATTATTGAAAGAGG + Intronic
1163816737 19:19470555-19470577 GTTCTACCAATTATTGAGAGTGG - Intronic
1165345265 19:35243457-35243479 GTTCTATCCATTATTGAAAGTGG - Intergenic
1166610392 19:44188193-44188215 GTTCTATCCATAATTGAAAGTGG + Intergenic
1168571006 19:57469707-57469729 GTTCCAGCAATTATTTTAAGAGG - Exonic
926554207 2:14338090-14338112 GTTCTATCAATTATTGAAAATGG + Intergenic
926937002 2:18096044-18096066 CGTCCATAAATTATAGACAGAGG + Intronic
927025969 2:19069569-19069591 CTTGTATAAATTATTGAAAAGGG - Intergenic
927406157 2:22770203-22770225 ATTCTATCAATTATTGAGAGAGG - Intergenic
927456589 2:23255972-23255994 CTTTAATCAATTATTGGGAGGGG - Intergenic
928164954 2:28964118-28964140 CTCCCATTAATTACTGAAATAGG + Intronic
929067629 2:37995562-37995584 GTTCCATTAATTACTAAAAGGGG - Intronic
929752852 2:44734920-44734942 GTTCCATCAATTACTGAGAGGGG + Intronic
931210168 2:60186125-60186147 GGTCTGTCAATTATTGAAAGAGG - Intergenic
931506050 2:62927686-62927708 CTTCTATCCATTATTGTGAGTGG - Intronic
931528633 2:63186933-63186955 GTCCTATCCATTATTGAAAGTGG + Intronic
932342231 2:70972029-70972051 ATTCTATCCATTACTGAAAGTGG + Intronic
932482082 2:72049441-72049463 GTTCTATCAATTACTGGAAGAGG - Intergenic
932554564 2:72809809-72809831 GTTCTATCAATTGTTGAGAGAGG - Intronic
933418393 2:82017164-82017186 TTTCCATACATTATTGAAAATGG + Intergenic
933484690 2:82904446-82904468 ATTTCATCTATCATTGAAAGTGG + Intergenic
933605070 2:84374245-84374267 CATCCATTAATTTTTTAAAGTGG + Intergenic
934973601 2:98784615-98784637 ATTCCATCATTTACTGAAAGAGG - Intergenic
934997344 2:98977279-98977301 GTTCTATCCATTATTGAAAGTGG - Intergenic
935138075 2:100324926-100324948 CTTGTATTAATTGTTGAAAGAGG - Intergenic
935460837 2:103331740-103331762 GGTCTATCAATTATTGATAGAGG + Intergenic
935475232 2:103512275-103512297 GTTCTATCAATTGTTGAGAGAGG + Intergenic
935480286 2:103579776-103579798 TTGCAATCCATTATTGAAAGTGG + Intergenic
935494361 2:103760580-103760602 GTTCTATAAATTATTGAAAGTGG - Intergenic
935723764 2:106003930-106003952 GTTATATCAATTATTGAGAGAGG + Intergenic
935752951 2:106254534-106254556 GTTTTATCCATTATTGAAAGTGG + Intergenic
935753971 2:106262791-106262813 TGTCCATTAATTATTGACAGAGG + Intergenic
935801102 2:106697284-106697306 CTTCCATCACTGATTAAGAGTGG + Intergenic
935913370 2:107922065-107922087 GTTTTATCCATTATTGAAAGTGG + Intergenic
936254241 2:110896799-110896821 GTTCCATCAATTGTTGAGAAAGG - Intronic
936379498 2:111971869-111971891 GTTCCATCTGTTATTGAAAATGG + Intronic
936828866 2:116616009-116616031 GTTCTATCTATTATTGAAAGTGG - Intergenic
937515347 2:122648777-122648799 ATTCTATCAGTTACTGAAAGAGG + Intergenic
937777893 2:125802663-125802685 GTTCTATCCATTATTGAAAGTGG - Intergenic
937962801 2:127474520-127474542 TTTCTATCAGTTATAGAAAGTGG - Intronic
938028044 2:127967718-127967740 GTTTCATCCATTATTGAAAGTGG - Intronic
938061353 2:128257480-128257502 GTTCTATCAATTTTTGAGAGAGG - Intronic
938253229 2:129832619-129832641 GTTCTATCAATTATTAAGAGTGG - Intergenic
938264810 2:129920676-129920698 CTTCTATCCATTATTGACAGGGG - Intergenic
938747868 2:134297358-134297380 CTTCCATGAAATATAGAAGGAGG + Intronic
939087098 2:137734114-137734136 GTTTAATCCATTATTGAAAGTGG + Intergenic
939682165 2:145150826-145150848 CTTCTATCAATTGTTGAAATGGG + Intergenic
940016192 2:149107921-149107943 GTTCTATCAATTATTGAAAGAGG + Intronic
941229586 2:162894119-162894141 GTTCTATCTATTATTAAAAGTGG + Intergenic
941949910 2:171144248-171144270 GTTCTATTCATTATTGAAAGTGG - Intronic
942160175 2:173177109-173177131 GTTCTATCAATTATTGAGAGTGG - Intronic
943113269 2:183634228-183634250 ATTCTATCAATTACTGAGAGAGG - Intergenic
943115420 2:183663835-183663857 ATTTCATCATTTATTGAATGTGG - Intergenic
943542034 2:189227777-189227799 ATTCCATCCATTATTAAAAGTGG - Intergenic
943939969 2:193980366-193980388 GTTCTACCAATTATTGAAAGAGG - Intergenic
944366342 2:198924162-198924184 ATTCTATCCATTAATGAAAGAGG - Intergenic
945149856 2:206779014-206779036 GTTCTATAAATTATTGAAAGTGG + Intronic
945527574 2:210907147-210907169 GATCTGTCAATTATTGAAAGAGG - Intergenic
945666975 2:212755341-212755363 CTTCGATCTAATATTGACAGTGG - Intergenic
947512450 2:230769324-230769346 GTTCTATCAATTATTGATAGTGG - Intronic
947706745 2:232282379-232282401 CCTTCATGATTTATTGAAAGTGG - Intronic
1169505355 20:6205102-6205124 GTTCTATCCATTATTGAAAGTGG + Intergenic
1169536452 20:6547337-6547359 GTTCTGTCCATTATTGAAAGTGG - Intergenic
1169999061 20:11595116-11595138 TTTCTATCCATTATTGAAAGTGG - Intergenic
1170340146 20:15316614-15316636 GTTCTATCCATTACTGAAAGTGG - Intronic
1170637497 20:18120295-18120317 GTTCTATCCATTATTGAAAGTGG - Intergenic
1170776903 20:19382960-19382982 TTTCCATCCATTTTTGACAGAGG + Intronic
1171301842 20:24068778-24068800 GTTCTATCTATTACTGAAAGTGG + Intergenic
1171940655 20:31325873-31325895 ATTCCATCCATTTTTGAAAGTGG - Intergenic
1171999664 20:31763533-31763555 GTTCCATCAATTAGAGAGAGAGG + Intronic
1172086965 20:32393125-32393147 GTTCTATCAATTATAGAGAGAGG + Intronic
1172567973 20:35945865-35945887 CTTACATTAAATATTTAAAGGGG + Intronic
1172660373 20:36564126-36564148 GTTCTATCTGTTATTGAAAGTGG - Intergenic
1173030261 20:39350903-39350925 AATCTATCAATTTTTGAAAGTGG - Intergenic
1173739446 20:45387192-45387214 GATTTATCAATTATTGAAAGAGG - Intronic
1173774782 20:45695353-45695375 GTTCTATTCATTATTGAAAGAGG - Intronic
1174908796 20:54583451-54583473 GTCCTATCCATTATTGAAAGTGG + Intronic
1175672241 20:60914286-60914308 GGTCTATCCATTATTGAAAGTGG + Intergenic
1176011375 20:62898169-62898191 CTTACCTCATTTATTGAAAGCGG - Intronic
1176926504 21:14756403-14756425 GTTCTATCAATTATTGAGTGTGG - Intergenic
1177345907 21:19870567-19870589 GTTCTATTCATTATTGAAAGTGG - Intergenic
1177496406 21:21897319-21897341 GATCTATCAATTACTGAAAGAGG + Intergenic
1177653969 21:23992895-23992917 CTTCCCTCAATTATAGAAGTAGG + Intergenic
1177695441 21:24565495-24565517 TTACCATCATTTATTGAATGTGG + Intergenic
1177817642 21:25995174-25995196 TTTCCATCAGTTATTAAAAATGG + Intronic
1177875232 21:26624738-26624760 GTTCTGTCTATTATTGAAAGTGG - Intergenic
1178324787 21:31635685-31635707 GTTCTATCCACTATTGAAAGTGG + Intergenic
1178616698 21:34140632-34140654 GTTCTATCGATTACTGAAAGAGG + Intronic
1178672255 21:34602314-34602336 CTTCCTGCATTTAGTGAAAGGGG - Intronic
1178697526 21:34807483-34807505 CTACCATCTATTTTTGAAAAAGG + Intronic
1178718353 21:34987112-34987134 CTTCAATCAATGGCTGAAAGAGG + Intronic
1178991108 21:37357492-37357514 CTTTCATTTATTTTTGAAAGGGG + Intergenic
1179360375 21:40702000-40702022 CTTCTACCAATTATTGAACTAGG + Intronic
1180633020 22:17242770-17242792 CTTCCCTCAACTAGTGAAATAGG - Intergenic
1181722441 22:24786221-24786243 CTTCCTTACATCATTGAAAGGGG + Intergenic
1183611628 22:38911549-38911571 GTTCTATCAATTACTGAAAATGG + Intergenic
1184494923 22:44834676-44834698 GTTCTATTTATTATTGAAAGTGG + Intronic
949569759 3:5281804-5281826 ATTGTATCCATTATTGAAAGTGG + Intergenic
949706310 3:6821754-6821776 CGTATATCAATTATTGAATGAGG - Intronic
950664491 3:14487048-14487070 CTGCCCTCAATCATTGACAGTGG - Exonic
950830497 3:15870483-15870505 GTTTTATCAATTATTGAAAGTGG - Intergenic
950961152 3:17109291-17109313 TTGTCATCAATTCTTGAAAGGGG + Intergenic
951455068 3:22882442-22882464 ATACTATCAATTACTGAAAGAGG - Intergenic
951924575 3:27894342-27894364 GTTCTATCCTTTATTGAAAGTGG - Intergenic
951942640 3:28097123-28097145 GTTTTATCCATTATTGAAAGTGG + Intergenic
952607037 3:35160582-35160604 GATCTATCAATTATTGAAAGAGG - Intergenic
952616005 3:35274909-35274931 GTTCTATCAATTATTGAATTAGG - Intergenic
953175636 3:40549299-40549321 CCTCTATCAATTATTGAGAATGG + Intronic
953594407 3:44295798-44295820 TTTCTATCAATTATTGAGAGAGG - Intronic
953895804 3:46799546-46799568 GTTTTATCAATTATTGATAGAGG - Intronic
954142364 3:48615064-48615086 GTTCTATTCATTATTGAAAGTGG + Intergenic
954407101 3:50351300-50351322 CTACCATAACTTATTGGAAGAGG + Exonic
954589336 3:51767939-51767961 GTTCTATCAATTATTGAAAGAGG + Intergenic
954591311 3:51785881-51785903 CATCTATTCATTATTGAAAGTGG + Intergenic
954738336 3:52726256-52726278 GTTCTATCCATTATTGAGAGTGG - Intronic
955262000 3:57400787-57400809 GTTCTATCCATTATTGAAAGTGG - Intronic
955916165 3:63911219-63911241 ATATCAACAATTATTGAAAGTGG + Intronic
955994243 3:64662471-64662493 GCTCTATCCATTATTGAAAGCGG + Intronic
956107400 3:65834648-65834670 GTTCTATCAATTATTGAGAGAGG + Intronic
956585847 3:70863902-70863924 CTTCACTCAATTTTTGAAACTGG - Intergenic
956898817 3:73692526-73692548 GGTCTATCAATTACTGAAAGAGG + Intergenic
958477198 3:94599923-94599945 CCAACATCAATTATTGAAAAGGG - Intergenic
958594715 3:96206812-96206834 CTTGTATCAATTATTGAGAGAGG - Intergenic
958921907 3:100116519-100116541 CCTCCATCCATTATGGAAAATGG + Intronic
959073510 3:101725582-101725604 CTTTCATCAATTTTTCAGAGGGG + Intronic
959987515 3:112591949-112591971 GTTCTATCCATTATTGAGAGTGG + Intergenic
960125058 3:113989214-113989236 CTTCTATCAGTTATTGAGAGAGG - Intronic
960777558 3:121275604-121275626 ATTCTATCAGTTATTAAAAGAGG + Intronic
960904004 3:122580225-122580247 GTTCTATCAATTATTTAGAGAGG + Intronic
961113605 3:124308238-124308260 GTTCCATCCATTATTAAAAGGGG - Intronic
962182221 3:133219892-133219914 TATCCATCCATTGTTGAAAGTGG + Intronic
962690238 3:137888953-137888975 CTTCCATCAATAAATGATACTGG - Intergenic
963114670 3:141716778-141716800 GTTCTATCAATTATTGAGAGAGG + Intergenic
963212789 3:142712437-142712459 CTTCCTCCAACTATTTAAAGTGG + Exonic
963508238 3:146214844-146214866 GTTCTATCTATTATTGTAAGTGG + Intronic
963530913 3:146472318-146472340 AATCTATCAATTATTCAAAGAGG + Intronic
964430903 3:156604972-156604994 ATTCACTCCATTATTGAAAGAGG - Intergenic
964521019 3:157566964-157566986 GTTGTATCCATTATTGAAAGTGG + Intronic
964572613 3:158125776-158125798 TTTCTGTCCATTATTGAAAGTGG + Intronic
965333316 3:167404725-167404747 GTTCTATTAATTATTGACAGAGG - Intergenic
965487086 3:169291660-169291682 ATAGCATCTATTATTGAAAGTGG + Intronic
965840771 3:172903030-172903052 CTTCCATTCTGTATTGAAAGTGG - Intronic
965929299 3:174023058-174023080 CATTCATAAATTATTGGAAGAGG + Intronic
966483481 3:180440495-180440517 GTTCTATCTATTATTGAAAGAGG - Intergenic
966541378 3:181094062-181094084 GTTCTATCAACTATTGATAGAGG + Intergenic
966589024 3:181659542-181659564 CTTCCAGAAAATATTTAAAGTGG - Intergenic
966981215 3:185137365-185137387 GTTCTGTCAATTGTTGAAAGAGG - Intronic
966998087 3:185304386-185304408 GTTCTATCCATTATTAAAAGTGG + Intronic
967760715 3:193223120-193223142 CTTTTACCCATTATTGAAAGGGG + Intergenic
968260442 3:197318412-197318434 TGTCTATCAATTATTGAAATAGG + Intergenic
968482417 4:841257-841279 GTTCTATCAATTACTGAAAGAGG + Intergenic
969127335 4:4960978-4961000 TTTCTATCAATTATTGAGATGGG + Intergenic
969283398 4:6186745-6186767 GTTCTATCTGTTATTGAAAGTGG + Intronic
970481084 4:16475881-16475903 GTTCTATCAACTATAGAAAGAGG - Intergenic
970677916 4:18473867-18473889 ATGCCATCAAGTATTGAAAAAGG - Intergenic
970876687 4:20878812-20878834 CTTCCAAGAACTATTGAAAGAGG - Intronic
972412046 4:38805184-38805206 CATCCATCCACTATTAAAAGTGG + Intronic
973225780 4:47782466-47782488 GTTCTATCCATTATTGAGAGTGG - Intronic
973925874 4:55736735-55736757 CTTCCACCTATTATCGAAGGTGG - Intergenic
973986424 4:56358879-56358901 TTTCAATCAATTATTGAAAGTGG + Intronic
974218011 4:58926131-58926153 ATTCTATCCATTATTGAAAATGG - Intergenic
974221609 4:58980811-58980833 ATTCCATCTATTAATGAAACAGG + Intergenic
974463288 4:62218559-62218581 CTGCCATTAATTTTGGAAAGGGG - Intergenic
974499181 4:62676322-62676344 GTTCTATCCATTATTTAAAGTGG + Intergenic
974541424 4:63242906-63242928 GTTCCATCTATTATTGAAAATGG - Intergenic
975873572 4:78809022-78809044 GTTCCATTCATTATTGAAAGAGG + Intronic
975934728 4:79565064-79565086 CTTTCATCACCTATTAAAAGTGG + Intergenic
976050502 4:81006790-81006812 TTTCAATCAATTATTAGAAGTGG + Intergenic
976854997 4:89593270-89593292 GTTCTATTCATTATTGAAAGTGG + Intergenic
976865872 4:89725807-89725829 CTGTGATTAATTATTGAAAGTGG - Exonic
977157023 4:93586899-93586921 CTTCCATGAATTTTTTAAAAGGG - Intronic
977178982 4:93849943-93849965 GTTCTATCAATTATTGAAAAAGG - Intergenic
977243905 4:94606506-94606528 CTTCCATCTCTTTTTGAAATAGG - Intronic
977547872 4:98406589-98406611 ATTCTATAAATTATTGAAAGAGG - Intronic
978135651 4:105255553-105255575 CTTTTAGCCATTATTGAAAGTGG + Intronic
978253753 4:106667656-106667678 CTTTCAGAAATTATTGAAAGAGG - Intergenic
978538704 4:109792231-109792253 CTTCTATTCATTATAGAAAGTGG + Intronic
979983721 4:127289270-127289292 TTTCCATTAATTATTGATAAAGG - Intergenic
980292864 4:130868038-130868060 TTTATATGAATTATTGAAAGTGG + Intergenic
980631203 4:135437176-135437198 AGTCTATCAATTATTGAAATTGG - Intergenic
981523101 4:145685023-145685045 TTTCCATCAGTTACTGACAGAGG - Intronic
981669062 4:147265004-147265026 ATTCTATCAATTATTAAGAGAGG + Intergenic
981939496 4:150267113-150267135 GTTCCACCCATTATTGAAAGTGG - Intronic
982441901 4:155445419-155445441 CTGACCTCAATTACTGAAAGAGG - Intergenic
984179100 4:176459207-176459229 AATCTATCAATTATTGAAAGAGG - Intergenic
984183746 4:176516386-176516408 CTTGTATCATTTACTGAAAGAGG - Intergenic
984720237 4:182965273-182965295 GTTCTGTCCATTATTGAAAGTGG - Intergenic
985804005 5:2026332-2026354 TTTCCATCAGTTATTCAGAGTGG + Intergenic
985843395 5:2326333-2326355 CTTCCAGCCCTTAATGAAAGGGG + Intergenic
985956918 5:3272555-3272577 CTGCCATGACTTATTTAAAGCGG + Intergenic
986852166 5:11826894-11826916 CTTTTATCAACTATTGAGAGGGG - Intronic
988881334 5:35506869-35506891 GCTCTATCCATTATTGAAAGTGG - Intergenic
989852558 5:46232938-46232960 CTTCCTTCTAGTATTTAAAGTGG - Intergenic
990088960 5:52016677-52016699 CTTCTATCCATTATTCAAAAAGG + Intronic
990325299 5:54669756-54669778 ATTCCAACAAGTATTGTAAGTGG + Intergenic
990396199 5:55381819-55381841 GGTCTATCTATTATTGAAAGTGG + Intronic
991193147 5:63899772-63899794 GTTCTATCAATTGTTGAGAGAGG - Intergenic
991527099 5:67572028-67572050 GATCTATCCATTATTGAAAGTGG + Intergenic
992273918 5:75095098-75095120 CTACCATACGTTATTGAAAGTGG - Intronic
992516185 5:77494729-77494751 GTTCTATCTATTATTGAAAGTGG - Intronic
992523458 5:77581423-77581445 GTTCTATCCATTATTAAAAGTGG - Intronic
992885405 5:81154129-81154151 ATTTCATCAATTATTTAGAGTGG - Intronic
993113805 5:83693868-83693890 GTTCCATCAATTGTTGATAAAGG - Intronic
993792763 5:92227106-92227128 CTCCCTTCAGTTATTGTAAGAGG + Intergenic
994129730 5:96212652-96212674 ATTATATCAATTGTTGAAAGAGG + Intergenic
994901539 5:105778158-105778180 GTTCTATCCATTATTGATAGTGG + Intergenic
995334267 5:110981425-110981447 CTTCTACCCATTATTGAAAGTGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995470556 5:112497279-112497301 ATTCCATCAGTTACTAAAAGAGG - Intergenic
995491771 5:112700588-112700610 GTTCTATCAATTACTGAGAGAGG + Intergenic
996320916 5:122215089-122215111 GATCTATCCATTATTGAAAGTGG - Intergenic
996458337 5:123711031-123711053 GTTGTATCCATTATTGAAAGTGG + Intergenic
996721572 5:126635677-126635699 CTTCCATCATTTTTGGAGAGGGG + Intronic
996851110 5:127953537-127953559 GTTCCATCAATTGTTGAAAGAGG - Intergenic
996897957 5:128507846-128507868 CTACTCTCAATTATTGAGAGGGG + Intronic
996903351 5:128569656-128569678 CTTCTAACAGTTATAGAAAGAGG - Intronic
997045430 5:130310678-130310700 ATTCTATCACTTATTGAAATAGG + Intergenic
997217589 5:132126986-132127008 GATCCATCTAATATTGAAAGTGG + Intergenic
998916996 5:147024390-147024412 GTTCTATCAATTACTGAGAGAGG - Intronic
998923019 5:147091431-147091453 GTTCCATCAATTGTTGTAAGAGG + Intergenic
998993818 5:147848788-147848810 TTTCCAACATTCATTGAAAGTGG + Intergenic
999563545 5:152832158-152832180 GTTCTAACAATTGTTGAAAGAGG + Intergenic
999724417 5:154423797-154423819 GTTCCATTCATTATTAAAAGTGG - Intergenic
999837018 5:155385039-155385061 CTTCTATTAATTGTTGAGAGTGG - Intergenic
1000028341 5:157379726-157379748 ATTCCATCAAATATTTAAGGAGG + Intronic
1000571570 5:162921298-162921320 GTTCTACCCATTATTGAAAGTGG + Intergenic
1001366355 5:171144548-171144570 CAGCCATCAATAAGTGAAAGAGG - Intronic
1002214786 5:177623051-177623073 ATTTTATCCATTATTGAAAGTGG + Intergenic
1002768430 6:264904-264926 GTTCTATCTATTACTGAAAGTGG + Intergenic
1003111738 6:3256794-3256816 CCTCCATCAGTTATTGTATGTGG + Intronic
1003219192 6:4142325-4142347 GTTCCATAAATTACTGAGAGAGG + Intergenic
1003842130 6:10132546-10132568 GTTCTATCAATTGTTGAATGTGG - Intronic
1004308990 6:14527352-14527374 CTTATATCAATTTTTGATAGAGG - Intergenic
1004829439 6:19461760-19461782 CTTCCATCAAATATTAATTGAGG - Intergenic
1005558728 6:27014946-27014968 GTTCTATCCATTATTCAAAGTGG - Intergenic
1005815122 6:29544807-29544829 GTTCCATCAATGATTGATAATGG + Intergenic
1007037865 6:38694368-38694390 GTTCTATCAATTGTTGAAAGAGG + Intronic
1007439846 6:41849366-41849388 GTTCTGTCCATTATTGAAAGTGG - Intronic
1007501305 6:42299532-42299554 TATCTATCAATTATTGAGAGAGG - Intronic
1007885065 6:45218418-45218440 CTTTCATCAATTGTTGAGATAGG - Intronic
1007920243 6:45602049-45602071 ATTCTATCAGTTATTGAGAGTGG - Intronic
1008314557 6:50024395-50024417 TTTGCATCCATTATTGAATGTGG - Intergenic
1008340739 6:50360923-50360945 GTTCCACCTATTATTGAAAAGGG - Intergenic
1008715018 6:54278194-54278216 GTTCTATCCATTATTAAAAGTGG - Intergenic
1008931187 6:56941878-56941900 GTTCTATCAATTGCTGAAAGAGG + Intronic
1008967871 6:57332442-57332464 GTTCTATCCATTATTGAAAGTGG + Intronic
1009835873 6:69001102-69001124 CTTCTATGAATTTTCGAAAGAGG + Intronic
1010421575 6:75682298-75682320 GTTCTATCAATTGTTGAGAGAGG - Intronic
1011168145 6:84474387-84474409 GTTTTATCTATTATTGAAAGTGG - Intergenic
1011222257 6:85067383-85067405 CTTGCATCAAATTCTGAAAGAGG - Intergenic
1011541067 6:88429905-88429927 GTTCTATCATTTATTGAAAGTGG + Intergenic
1013202602 6:107914562-107914584 CTTTCATCAAATAGTGTAAGTGG - Intronic
1013698720 6:112736511-112736533 GTTCTATCAATTATTGAGAGAGG - Intergenic
1014024710 6:116631911-116631933 CTTCCTTCAATTATTTTCAGGGG - Intronic
1014096004 6:117462649-117462671 GTTCTATCAATTGCTGAAAGAGG + Intronic
1014149456 6:118036882-118036904 GTTCTATCAATTTCTGAAAGAGG + Intronic
1014201288 6:118611916-118611938 TTTCTATCAGTTGTTGAAAGAGG - Intronic
1014700133 6:124676395-124676417 GTTCTATCCATTATTGAATGTGG + Intronic
1014975129 6:127870909-127870931 CTTCTATCAGTTGTTGAAAGAGG - Intronic
1015232108 6:130927026-130927048 CTTCCATCAATTCCTCAAGGTGG + Intronic
1015305907 6:131708115-131708137 GTTCTATCAATTATTGAAAAAGG + Intronic
1016059554 6:139615594-139615616 GTTCTATCAAATATTGAGAGAGG + Intergenic
1017454021 6:154582514-154582536 CTTGTATCAATTATTGATAGAGG - Intergenic
1017932265 6:158967652-158967674 AGTCTATCCATTATTGAAAGTGG + Intergenic
1019107508 6:169680965-169680987 GTTCAGTCAGTTATTGAAAGAGG - Intronic
1019583746 7:1784221-1784243 GTTCTATCAATTACTGAAGGAGG + Intergenic
1020451150 7:8321863-8321885 TTTCCAACAATTATTAAAAGAGG + Intergenic
1020714995 7:11662475-11662497 CTTCTATTAGTTAATGAAAGAGG - Intronic
1020941737 7:14547981-14548003 CTTCTAACAATTATAGAAAATGG - Intronic
1021210067 7:17839323-17839345 GTTTTATCAATTATTGAAAGTGG + Intronic
1021310183 7:19085202-19085224 GTTCTATCCATTATTGAAAGTGG - Intronic
1021661446 7:22922981-22923003 GTTCTATCTATGATTGAAAGTGG - Intergenic
1021771981 7:24012875-24012897 ATTCTAACCATTATTGAAAGTGG - Intergenic
1022331030 7:29379176-29379198 CATGCATAAATTAATGAAAGAGG + Intronic
1022585888 7:31610523-31610545 GTTTCATCCATTATTGAAAGTGG + Intronic
1023195454 7:37633405-37633427 GTTCAGTCAATTATTGATAGAGG + Intergenic
1023269139 7:38441295-38441317 GTTCTTTCAATTATTGAATGAGG - Intronic
1023272940 7:38485524-38485546 GTTCTATCTATAATTGAAAGAGG - Intronic
1023664179 7:42503558-42503580 GTTCTATCAATTAGTGAAAGAGG + Intergenic
1023910365 7:44551111-44551133 GTTCCATCAATTATTGAAAATGG - Intergenic
1024052454 7:45635904-45635926 GTTCTCTCAATTATTGAGAGAGG + Intronic
1024120546 7:46233591-46233613 GTTTCATCAATTACTGAAAGAGG - Intergenic
1024818559 7:53299987-53300009 CTTCCAGCAATTTCTGCAAGAGG - Intergenic
1025169781 7:56746016-56746038 GTTCTATTCATTATTGAAAGTGG + Intergenic
1025702110 7:63829695-63829717 GTTCTATTCATTATTGAAAGTGG - Intergenic
1025861191 7:65330620-65330642 TTTCTATTCATTATTGAAAGTGG + Intergenic
1026083941 7:67247108-67247130 CTTCTATCTATTATTGGAAGTGG - Intergenic
1026693091 7:72566919-72566941 CTTCTATCTATTATTGGAAGTGG + Intronic
1027562185 7:79744924-79744946 TTTACAGCAATTATAGAAAGTGG - Intergenic
1030461128 7:109838513-109838535 ATTTAATCCATTATTGAAAGTGG - Intergenic
1030501165 7:110361410-110361432 GATCTATCCATTATTGAAAGTGG + Intergenic
1030776538 7:113540025-113540047 TATCCATCCATTGTTGAAAGTGG - Intergenic
1031289319 7:119913068-119913090 GCTCTATTAATTATTGAAAGGGG + Intergenic
1031520787 7:122763002-122763024 TTTCCATCTACTATTGAAACTGG - Intronic
1031876571 7:127148390-127148412 CATCTATCTATTGTTGAAAGTGG - Intronic
1032043750 7:128584863-128584885 GTTCTATCAATTATTAAGAGCGG + Intergenic
1032314683 7:130824721-130824743 GTCCTATCCATTATTGAAAGTGG + Intergenic
1033731643 7:144186385-144186407 GTTCTATCAATTATTGAAAAAGG - Exonic
1033740022 7:144266348-144266370 GTTCTATCAATTATTGAAAAAGG + Intergenic
1034229135 7:149507218-149507240 TTTCTATCAGTTATGGAAAGAGG - Intergenic
1035549696 8:511535-511557 CTTCTATCCATTATTGAAAGTGG - Intronic
1036019369 8:4826580-4826602 CTTCCATCAGTTGTTTAAGGTGG - Intronic
1036112911 8:5925059-5925081 CTTCCATCAATTACTGTGGGAGG - Intergenic
1037014784 8:13889579-13889601 TTTCCATTCATTTTTGAAAGTGG + Intergenic
1037385863 8:18340622-18340644 CTTTGATCTTTTATTGAAAGTGG - Intergenic
1038051419 8:23816887-23816909 GTTCTATCAGTTATTGAGAGAGG + Intergenic
1038222014 8:25618403-25618425 ATTCTATTCATTATTGAAAGAGG - Intergenic
1038783912 8:30593323-30593345 GTTCAATCAACTACTGAAAGAGG + Intronic
1039017334 8:33165880-33165902 ATTCCATCAATTATTGACAGAGG - Intergenic
1039660580 8:39458842-39458864 CTTCTATCAATTACTAAGAGAGG - Intergenic
1040442252 8:47455921-47455943 GTTCTGTCCATTATTGAAAGTGG - Intronic
1040697395 8:50017832-50017854 GTTTTATCCATTATTGAAAGTGG - Intronic
1041128548 8:54670323-54670345 TTTCTATCCATTATTGAAAGTGG + Intergenic
1041545660 8:59039729-59039751 TTTCTGTAAATTATTGAAAGAGG + Intronic
1041657243 8:60365967-60365989 GTTCCATTCATTATTGGAAGTGG - Intergenic
1042148093 8:65753694-65753716 GTCCTATCCATTATTGAAAGTGG + Intronic
1042399985 8:68333408-68333430 CTCCCTTCAATTATTTAAAGTGG - Intronic
1042900526 8:73721481-73721503 CTTCTATCAATTATTGACAGGGG + Intronic
1043656403 8:82673555-82673577 GTTCTATTAATTATTGTAAGTGG - Intergenic
1043844385 8:85147976-85147998 GTTCTATCCATGATTGAAAGTGG - Intergenic
1043990621 8:86749449-86749471 CATCCATCTGTTATTGAAAGTGG + Intergenic
1044612190 8:94103304-94103326 CTTCTATAAATTACTGAGAGAGG + Intergenic
1045190882 8:99882157-99882179 GTTCTGTCAATTATTGAAAGTGG - Intronic
1045562074 8:103273831-103273853 TTTCTATCCATTATTGAAACTGG + Intergenic
1045583505 8:103502342-103502364 CTACTATAAATTATTTAAAGTGG - Intronic
1045825253 8:106389515-106389537 ATTCCATGAATTACTGAAAAAGG - Intronic
1046066434 8:109202561-109202583 GCTTTATCAATTATTGAAAGAGG + Intergenic
1046439288 8:114237025-114237047 CTTCCAGCACATAGTGAAAGGGG - Intergenic
1046696668 8:117348310-117348332 ATTCCATCAAACATTTAAAGAGG + Intergenic
1046843533 8:118888376-118888398 ATTCTACCCATTATTGAAAGTGG - Intergenic
1046919567 8:119713936-119713958 GTTCTATCCATTATTGGAAGTGG + Intergenic
1047326750 8:123846198-123846220 GATCTATCAATTATTGACAGAGG + Intergenic
1047635462 8:126756824-126756846 CTTCCATCAGTTCTTCAAAAGGG + Intergenic
1047639886 8:126807202-126807224 GTTCTATCCATTATTGAAAATGG + Intergenic
1048945112 8:139439316-139439338 GTTCTATCAGTTATTGAAGGGGG - Intergenic
1049281368 8:141748584-141748606 ATTCAGTCAATTATTGAAAGAGG - Intergenic
1049318198 8:141980903-141980925 CTGCCATCACTTCTAGAAAGTGG - Intergenic
1050130324 9:2405936-2405958 AATCCGTCAATTGTTGAAAGTGG - Intergenic
1050444702 9:5707441-5707463 GTTCTATCCATTATTGAAAGTGG + Intronic
1050890128 9:10814680-10814702 ATTCCATACATTATTGAAAGTGG + Intergenic
1050980914 9:12014259-12014281 ATTTTATCTATTATTGAAAGTGG + Intergenic
1051296761 9:15604619-15604641 ATTCCATGAACTATAGAAAGAGG + Intronic
1051464421 9:17360994-17361016 TTTCCATCAATTACTGGGAGAGG + Intronic
1051471012 9:17442098-17442120 GTTCTATCCATTGTTGAAAGTGG - Intronic
1051563790 9:18473108-18473130 TTTCCATCCACTATTGCAAGAGG - Intergenic
1051936050 9:22444065-22444087 ATACTATCAATTATTGAAGGAGG + Intergenic
1052179852 9:25511692-25511714 GTTCTATCCATTACTGAAAGTGG + Intergenic
1052453132 9:28658310-28658332 GTTCTATCCATTATTGAAAGTGG + Intronic
1052785185 9:32821736-32821758 CCTCCATTAATGAATGAAAGTGG + Intergenic
1052892371 9:33714915-33714937 GTTATATCAATTATTGAAAGAGG - Intergenic
1052968263 9:34359358-34359380 GTTCTATGTATTATTGAAAGTGG + Intergenic
1053336706 9:37280297-37280319 CTTCTGTCAATTATTGAGACAGG - Intronic
1053520829 9:38777538-38777560 GTTCTACCCATTATTGAAAGTGG - Intergenic
1054192987 9:62001531-62001553 GTTCTACCCATTATTGAAAGTGG - Intergenic
1054645422 9:67587160-67587182 GTTCTACCCATTATTGAAAGTGG + Intergenic
1055251052 9:74305999-74306021 CTTCCATAAATTTTATAAAGTGG - Intergenic
1055798949 9:80010458-80010480 GTTCTATCCATTATTGAAAATGG + Intergenic
1055953226 9:81750228-81750250 ATTCTATCATTTATTGAGAGAGG + Intergenic
1056701306 9:88912010-88912032 GTTTTATCAATTATTGAGAGAGG - Intergenic
1057056760 9:91968594-91968616 TTTCTATCAATTATTGAATGAGG - Intergenic
1057634406 9:96750058-96750080 GTTCCATCAATTGTTGAGAGAGG + Intergenic
1057641670 9:96829535-96829557 CTTCTATAAATTATTGAGAAAGG - Intronic
1057668472 9:97066412-97066434 GTTCTATCTATTGTTGAAAGTGG - Intergenic
1059572105 9:115449914-115449936 GTTCTATCAATTATTGAAAAAGG + Intergenic
1060844310 9:126823179-126823201 TTTCTATCAATTCTTGAAAGTGG + Intronic
1061654279 9:132076623-132076645 CTAACAACAATTATTCAAAGAGG + Intronic
1061694310 9:132360282-132360304 GTTACATCCATTATTGAAAATGG + Intergenic
1185678467 X:1868208-1868230 GATGTATCAATTATTGAAAGAGG - Intergenic
1186514894 X:10159650-10159672 TTTCCATCAATAATTGAAGGAGG + Intronic
1188252465 X:27914512-27914534 CTTCCATCAATCATTGATTGAGG + Intergenic
1189190775 X:39102008-39102030 ATTCTATCAATTATTGAGAGAGG - Intergenic
1189950390 X:46224104-46224126 CCTCTATCAGTTATTGAGAGGGG - Intergenic
1189951582 X:46236982-46237004 ATTCTATCTATTATTGAAAGTGG - Intergenic
1190030559 X:46968857-46968879 GTTCTATCAATTACTGAAAGAGG - Intronic
1190034402 X:47007351-47007373 GTTCTATCAATTATTGAGAGAGG + Intronic
1190151885 X:47956222-47956244 CATCCAGCAAATATTGGAAGTGG + Intronic
1190292131 X:49000062-49000084 CCTCCCTTAATTATTGAAGGGGG - Intronic
1190377250 X:49800627-49800649 GTTCTATCAATTATTGAAAGAGG - Intergenic
1190589660 X:51986904-51986926 GTTCTATGAAGTATTGAAAGTGG + Intergenic
1190849528 X:54224888-54224910 GTTCTATCAGTTATTAAAAGTGG - Intronic
1191699806 X:64028916-64028938 GTTCTATCCATTATTGAAAGTGG + Intergenic
1191790089 X:64961021-64961043 GTTCCATCCATTATTAAAAGTGG + Intronic
1191793655 X:64998678-64998700 GTTCTATCAATTATTGAGAGTGG + Intronic
1192124043 X:68484724-68484746 GTTCTATCAATTACTGAGAGAGG - Intergenic
1192382340 X:70631077-70631099 ATTCTATCAGTTATTGAGAGAGG - Intronic
1192540258 X:71963189-71963211 GTTCTGTCCATTATTGAAAGTGG + Intergenic
1192659558 X:73028240-73028262 CTTCTCTCAATTGTTGAGAGAGG - Intergenic
1192918070 X:75675296-75675318 GTTCTATCCATTATTGAAAGTGG - Intergenic
1193237418 X:79125014-79125036 CTTTTATCAGTTATTGAAAGGGG - Intergenic
1193254583 X:79332237-79332259 GATCTATCCATTATTGAAAGGGG + Intergenic
1193500801 X:82271894-82271916 ATTCTATGTATTATTGAAAGTGG - Intergenic
1193636480 X:83956218-83956240 GATCCATCTAATATTGAAAGTGG - Intergenic
1193911529 X:87312536-87312558 GTTCTATCAATTATTGAGAAAGG + Intergenic
1194006090 X:88494507-88494529 GTTCCATCCATTATTGAAAATGG + Intergenic
1194362612 X:92972693-92972715 TTTCTATCAATTATTGAAAGTGG + Intergenic
1194636766 X:96354393-96354415 TTTTGATCCATTATTGAAAGTGG - Intergenic
1194759584 X:97778992-97779014 GTTCTACCAATTATTGAAAGAGG - Intergenic
1194891815 X:99388310-99388332 GTTCTATCCATTATTGAAAATGG + Intergenic
1194989669 X:100533611-100533633 GTTCTATCCATTATTGAAAGTGG + Intergenic
1195582688 X:106525970-106525992 GTTCTATCCATTATTAAAAGTGG + Intergenic
1195686887 X:107595627-107595649 GTTTTATCCATTATTGAAAGTGG + Intronic
1195800928 X:108709243-108709265 GTTCTGTCCATTATTGAAAGTGG + Intergenic
1196051168 X:111306497-111306519 GTTCTATCCATTATTGAAAGTGG - Intronic
1196125264 X:112091802-112091824 CATCTATCTATTATTGAAAGTGG + Intergenic
1196142007 X:112273626-112273648 GTTCCATCATTTGTTGAAAGTGG + Intergenic
1196727618 X:118910945-118910967 GTTCTATCCATTATTAAAAGTGG + Intergenic
1197574392 X:128192171-128192193 GTTCTATCCATTATTAAAAGTGG + Intergenic
1197842400 X:130762895-130762917 GTTATATCAATTATTGAGAGAGG + Intronic
1197861447 X:130975194-130975216 TTTCCATTCATTATGGAAAGGGG + Intergenic
1198071926 X:133157647-133157669 GTTCTATCCATTATTTAAAGTGG + Intergenic
1198195635 X:134358412-134358434 CGACTATCTATTATTGAAAGTGG - Intergenic
1198313318 X:135441246-135441268 CTTCTATCCATTATTGAGTGTGG - Intergenic
1198475007 X:136987065-136987087 GTTGTATCCATTATTGAAAGTGG + Intergenic
1199663332 X:150075572-150075594 GTTCCATCAATAAATGAGAGAGG - Intergenic
1199737810 X:150701078-150701100 CTTTGATGAATTATTGTAAGGGG + Intronic
1200315696 X:155131075-155131097 GTTCTATCCACTATTGAAAGTGG - Intronic
1200422658 Y:2988285-2988307 TTTCTACCCATTATTGAAAGTGG + Intergenic
1200600987 Y:5205809-5205831 CTTCATTCAATGATTGAATGGGG - Intronic
1200670866 Y:6088913-6088935 TTTCTATCAATTATTGAAAGTGG + Intergenic
1201014614 Y:9587866-9587888 CTTTTATCATTTATTAAAAGAGG - Intergenic