ID: 1118426196 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:65665930-65665952 |
| Sequence | GAGGGTGGACAATGGGAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4952 | |||
| Summary | {0: 1, 1: 34, 2: 296, 3: 1488, 4: 3133} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118426186_1118426196 | -1 | Left | 1118426186 | 14:65665908-65665930 | CCACAGACACTGGGGCCTATCGG | 0: 1 1: 2 2: 13 3: 48 4: 174 |
||
| Right | 1118426196 | 14:65665930-65665952 | GAGGGTGGACAATGGGAGGAGGG | 0: 1 1: 34 2: 296 3: 1488 4: 3133 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118426196 | Original CRISPR | GAGGGTGGACAATGGGAGGA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||