ID: 1118426196

View in Genome Browser
Species Human (GRCh38)
Location 14:65665930-65665952
Sequence GAGGGTGGACAATGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4952
Summary {0: 1, 1: 34, 2: 296, 3: 1488, 4: 3133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118426186_1118426196 -1 Left 1118426186 14:65665908-65665930 CCACAGACACTGGGGCCTATCGG 0: 1
1: 2
2: 13
3: 48
4: 174
Right 1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG 0: 1
1: 34
2: 296
3: 1488
4: 3133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118426196 Original CRISPR GAGGGTGGACAATGGGAGGA GGG Intronic
Too many off-targets to display for this crispr