ID: 1118434162

View in Genome Browser
Species Human (GRCh38)
Location 14:65754232-65754254
Sequence CAGGTAAGATTCAGAACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118434162_1118434167 24 Left 1118434162 14:65754232-65754254 CCTACAGTTCTGAATCTTACCTG No data
Right 1118434167 14:65754279-65754301 ATGAACATGGTATGACTGGATGG No data
1118434162_1118434165 11 Left 1118434162 14:65754232-65754254 CCTACAGTTCTGAATCTTACCTG No data
Right 1118434165 14:65754266-65754288 AGTAGATTTTTAAATGAACATGG No data
1118434162_1118434166 20 Left 1118434162 14:65754232-65754254 CCTACAGTTCTGAATCTTACCTG No data
Right 1118434166 14:65754275-65754297 TTAAATGAACATGGTATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118434162 Original CRISPR CAGGTAAGATTCAGAACTGT AGG (reversed) Intergenic
No off target data available for this crispr