ID: 1118434334

View in Genome Browser
Species Human (GRCh38)
Location 14:65755755-65755777
Sequence CATAGCTCCAAGTCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118434334_1118434337 -1 Left 1118434334 14:65755755-65755777 CCTGCTTGTGACTTGGAGCTATG No data
Right 1118434337 14:65755777-65755799 GAGCCTCCAGGAAAATCCTCGGG No data
1118434334_1118434336 -2 Left 1118434334 14:65755755-65755777 CCTGCTTGTGACTTGGAGCTATG No data
Right 1118434336 14:65755776-65755798 TGAGCCTCCAGGAAAATCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118434334 Original CRISPR CATAGCTCCAAGTCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr