ID: 1118437140

View in Genome Browser
Species Human (GRCh38)
Location 14:65781968-65781990
Sequence TTAGATCCTGAAAATGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118437140_1118437145 0 Left 1118437140 14:65781968-65781990 CCCTGGCCATTTTCAGGATCTAA No data
Right 1118437145 14:65781991-65782013 TGGGCAGAACATGCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118437140 Original CRISPR TTAGATCCTGAAAATGGCCA GGG (reversed) Intergenic
No off target data available for this crispr