ID: 1118438829

View in Genome Browser
Species Human (GRCh38)
Location 14:65794549-65794571
Sequence CAACCCAGAGGGACGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118438829_1118438836 16 Left 1118438829 14:65794549-65794571 CCCATCATCGTCCCTCTGGGTTG No data
Right 1118438836 14:65794588-65794610 CCATGCTGTGGTCTGAAGTTAGG No data
1118438829_1118438833 4 Left 1118438829 14:65794549-65794571 CCCATCATCGTCCCTCTGGGTTG No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118438829 Original CRISPR CAACCCAGAGGGACGATGAT GGG (reversed) Intergenic
No off target data available for this crispr