ID: 1118438833

View in Genome Browser
Species Human (GRCh38)
Location 14:65794576-65794598
Sequence GAGTGTGTGCCTCCATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118438829_1118438833 4 Left 1118438829 14:65794549-65794571 CCCATCATCGTCCCTCTGGGTTG No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438830_1118438833 3 Left 1118438830 14:65794550-65794572 CCATCATCGTCCCTCTGGGTTGT No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438822_1118438833 29 Left 1118438822 14:65794524-65794546 CCCAGGAGACTCCACTTCGAGTG No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438826_1118438833 18 Left 1118438826 14:65794535-65794557 CCACTTCGAGTGGGCCCATCATC No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438832_1118438833 -8 Left 1118438832 14:65794561-65794583 CCTCTGGGTTGTGTTGAGTGTGT No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438831_1118438833 -7 Left 1118438831 14:65794560-65794582 CCCTCTGGGTTGTGTTGAGTGTG No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data
1118438823_1118438833 28 Left 1118438823 14:65794525-65794547 CCAGGAGACTCCACTTCGAGTGG No data
Right 1118438833 14:65794576-65794598 GAGTGTGTGCCTCCATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118438833 Original CRISPR GAGTGTGTGCCTCCATGCTG TGG Intergenic
No off target data available for this crispr