ID: 1118442638

View in Genome Browser
Species Human (GRCh38)
Location 14:65826257-65826279
Sequence AATCTGAATGGGGCTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118442630_1118442638 6 Left 1118442630 14:65826228-65826250 CCGGGTGAATGAAATGACCAGAT No data
Right 1118442638 14:65826257-65826279 AATCTGAATGGGGCTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118442638 Original CRISPR AATCTGAATGGGGCTTTTCA GGG Intergenic