ID: 1118442912

View in Genome Browser
Species Human (GRCh38)
Location 14:65828157-65828179
Sequence CAAGGTGGTCAAGGGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118442902_1118442912 22 Left 1118442902 14:65828112-65828134 CCATCTCCTGAAAGGGAATCAGT No data
Right 1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG No data
1118442904_1118442912 16 Left 1118442904 14:65828118-65828140 CCTGAAAGGGAATCAGTGCAGGC No data
Right 1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118442912 Original CRISPR CAAGGTGGTCAAGGGGCGGA TGG Intergenic
No off target data available for this crispr