ID: 1118444996

View in Genome Browser
Species Human (GRCh38)
Location 14:65842760-65842782
Sequence ATGGATGTAGGGATTGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118444996_1118445000 -6 Left 1118444996 14:65842760-65842782 CCACGCACAATCCCTACATCCAT No data
Right 1118445000 14:65842777-65842799 ATCCATCAGGTGAGTTAAAAAGG No data
1118444996_1118445002 -3 Left 1118444996 14:65842760-65842782 CCACGCACAATCCCTACATCCAT No data
Right 1118445002 14:65842780-65842802 CATCAGGTGAGTTAAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118444996 Original CRISPR ATGGATGTAGGGATTGTGCG TGG (reversed) Intergenic