ID: 1118446033

View in Genome Browser
Species Human (GRCh38)
Location 14:65851956-65851978
Sequence AGCAACGTGATGTACGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118446033_1118446036 26 Left 1118446033 14:65851956-65851978 CCACTAGCGTACATCACGTTGCT No data
Right 1118446036 14:65852005-65852027 TTCTTTCCTCTAGTTGCCAAAGG No data
1118446033_1118446037 27 Left 1118446033 14:65851956-65851978 CCACTAGCGTACATCACGTTGCT No data
Right 1118446037 14:65852006-65852028 TCTTTCCTCTAGTTGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118446033 Original CRISPR AGCAACGTGATGTACGCTAG TGG (reversed) Intergenic
No off target data available for this crispr