ID: 1118447095

View in Genome Browser
Species Human (GRCh38)
Location 14:65861963-65861985
Sequence TCTGGGGCCCTGTGCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118447089_1118447095 -6 Left 1118447089 14:65861946-65861968 CCTGGTAGTTTTCTTGCTCTGGG No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data
1118447086_1118447095 -2 Left 1118447086 14:65861942-65861964 CCCTCCTGGTAGTTTTCTTGCTC No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data
1118447083_1118447095 21 Left 1118447083 14:65861919-65861941 CCAAGCCGGCTCAGTTTTGATTT No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data
1118447087_1118447095 -3 Left 1118447087 14:65861943-65861965 CCTCCTGGTAGTTTTCTTGCTCT No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data
1118447082_1118447095 22 Left 1118447082 14:65861918-65861940 CCCAAGCCGGCTCAGTTTTGATT No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data
1118447084_1118447095 16 Left 1118447084 14:65861924-65861946 CCGGCTCAGTTTTGATTTCCCTC No data
Right 1118447095 14:65861963-65861985 TCTGGGGCCCTGTGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118447095 Original CRISPR TCTGGGGCCCTGTGCTGGAG GGG Intergenic
No off target data available for this crispr