ID: 1118447723

View in Genome Browser
Species Human (GRCh38)
Location 14:65866989-65867011
Sequence TTGCCCTTCCCATTAACGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118447717_1118447723 9 Left 1118447717 14:65866957-65866979 CCTCATCTGTACTGTCTGTCTCA No data
Right 1118447723 14:65866989-65867011 TTGCCCTTCCCATTAACGCCAGG No data
1118447715_1118447723 30 Left 1118447715 14:65866936-65866958 CCCTGACACTCTGATGGGGATCC No data
Right 1118447723 14:65866989-65867011 TTGCCCTTCCCATTAACGCCAGG No data
1118447716_1118447723 29 Left 1118447716 14:65866937-65866959 CCTGACACTCTGATGGGGATCCT No data
Right 1118447723 14:65866989-65867011 TTGCCCTTCCCATTAACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118447723 Original CRISPR TTGCCCTTCCCATTAACGCC AGG Intergenic
No off target data available for this crispr