ID: 1118448985

View in Genome Browser
Species Human (GRCh38)
Location 14:65880169-65880191
Sequence CACTTTGCAAAGCTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118448982_1118448985 20 Left 1118448982 14:65880126-65880148 CCACTTGCACAGAGCTTCCTTCT 0: 1
1: 1
2: 3
3: 35
4: 290
Right 1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG 0: 1
1: 1
2: 1
3: 16
4: 184
1118448983_1118448985 3 Left 1118448983 14:65880143-65880165 CCTTCTCACAATTCTCATCACAC No data
Right 1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG 0: 1
1: 1
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118448985 Original CRISPR CACTTTGCAAAGCTTGTGCA GGG Intergenic
903054419 1:20625611-20625633 CTCTTTGCAAAGCTAATGAAAGG - Intergenic
906412645 1:45591598-45591620 CACTTTGAAAGGCTTAGGCAGGG - Intronic
907733260 1:57087893-57087915 TACTTGGCAGAGCTGGTGCAGGG + Intronic
909194770 1:72604672-72604694 CACTTTGTAAAGCCTGTCAAGGG - Intergenic
913535784 1:119770758-119770780 CAAATTGCAAAGTGTGTGCAAGG - Intergenic
918109531 1:181443081-181443103 CACTTTGCAAAGCCAGAGCCAGG - Intronic
918767902 1:188512470-188512492 CACTCTGCAAGGCATGTCCATGG + Intergenic
919982208 1:202649158-202649180 CACTGTCCAAAGCTGCTGCATGG - Intronic
920195653 1:204224643-204224665 CACGATACAAAGTTTGTGCATGG + Intronic
920527917 1:206682253-206682275 TACTTTGTAGGGCTTGTGCAAGG - Intronic
923926006 1:238628432-238628454 TACTTTGCAGAGCTTGGACAAGG - Intergenic
923989926 1:239424941-239424963 CATTTTGCAAAGCTCATGCTGGG + Intronic
924333557 1:242964687-242964709 CTCTTTGCCAAGCTTGTGCTTGG - Intergenic
924639925 1:245824170-245824192 CTCTATGCCAAGCTTGTGCAGGG - Intronic
1067404657 10:46010674-46010696 CACTCTGCAAAGCTTGTGCAGGG + Exonic
1069920922 10:71815220-71815242 CACGTCGCGAAGTTTGTGCAGGG - Exonic
1071899580 10:90105868-90105890 CAATTTAAAAAGCTTCTGCATGG + Intergenic
1072507728 10:96085754-96085776 TACATTACAAAGTTTGTGCAAGG + Intergenic
1072655907 10:97330345-97330367 CCATTTGCAAAGCCTGTGGAGGG - Intergenic
1075534676 10:123260375-123260397 CCCTTTGCAGGGCTTTTGCAGGG - Intergenic
1079388286 11:19999804-19999826 CACTGTGCTAACCTTGTGCCTGG - Intronic
1081081365 11:38743845-38743867 CACTTTCCAATTCTTGTCCATGG + Intergenic
1081386313 11:42477728-42477750 CATTTTTCAAAGCTGGTGTAAGG - Intergenic
1081552609 11:44127959-44127981 CACTTTCCCAAGATTTTGCAGGG + Intronic
1083195556 11:61083797-61083819 CACTTTACAAAGCATTTGCACGG - Intergenic
1085763097 11:79259193-79259215 TACTTTGCACAGCTTGGTCAAGG + Intronic
1085976381 11:81660336-81660358 CAGTTTCCCAAGGTTGTGCAGGG + Intergenic
1089810536 11:121127990-121128012 CACTGTGCAATGCCTGTGCGAGG + Exonic
1091057340 11:132431161-132431183 TACTGTGCAAAGATTGTCCATGG + Intronic
1092684094 12:11021881-11021903 CAGTTTGCAAAGCTTTTATATGG + Exonic
1094044812 12:26155769-26155791 CACTTTGCTAAGCTTTTCCCAGG + Intronic
1096090703 12:48898658-48898680 CACCTTGCAAGGCTGGAGCATGG + Intergenic
1096555459 12:52400869-52400891 CACTTTGCAGAGCCTGGGCCTGG + Intronic
1097136844 12:56864278-56864300 CACTGTTCCAAGGTTGTGCAGGG - Intergenic
1099839728 12:87950392-87950414 CACTTTGCACAGCTTGTACTTGG - Intergenic
1100965543 12:100009462-100009484 CACTTTGCACAACTTGTACTTGG + Intergenic
1106111740 13:26783571-26783593 CACTCAGCAAAACTTGTGCTGGG + Intergenic
1106449901 13:29871282-29871304 TCCTTTGCAAAACTTCTGCATGG - Intergenic
1108424090 13:50280363-50280385 CACATTGTAAAGCTTCTGGAAGG + Intronic
1108542898 13:51460881-51460903 CACTTTGCACAACTTGTACTTGG - Intergenic
1111946811 13:94674254-94674276 CACTTGACAGAGCTTGTCCAAGG + Intergenic
1116074935 14:40099806-40099828 CACATTGCAAAGTATGTGCCAGG + Intergenic
1117262342 14:54048537-54048559 CACCTTGCCTGGCTTGTGCAAGG + Intergenic
1117433959 14:55698819-55698841 CCCTTTGCAAAGCATGTGTGAGG - Intronic
1117487543 14:56213328-56213350 CACTGTGCAAAGCTTCTGCCTGG - Intronic
1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG + Intergenic
1122588646 14:102829227-102829249 CATTCTGAAAAGCTTGTGAATGG + Intronic
1124245271 15:28065117-28065139 CACTTTGCAAAGACTGGGAAAGG - Intronic
1127171786 15:56310605-56310627 TACTTGGCAGAGCTGGTGCAGGG - Intronic
1127628390 15:60802482-60802504 TCCTTGGCAAAGCTTCTGCAGGG - Intronic
1128543204 15:68551138-68551160 CACTTTGGAAAGCGAGTGCTGGG - Intergenic
1131140804 15:89975644-89975666 CACTTCACAAAGCATTTGCAAGG - Intergenic
1135575865 16:23585113-23585135 CACTCTGCTGGGCTTGTGCAAGG + Intronic
1137058364 16:35757645-35757667 CACATTGCAAAGCATTTTCACGG + Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1141324627 16:83044783-83044805 CACTTGGGAAAGCCTGTGGATGG - Intronic
1142540754 17:657207-657229 CACTTTGCACAACTTGTACTTGG + Intronic
1144079653 17:11752208-11752230 CGCTTTCCAAAGCTTGTGTTTGG + Intronic
1144445722 17:15326281-15326303 GACCCTGCAAAGCTTGTGCAGGG + Intronic
1147160728 17:38568121-38568143 CCCGGTGCAAAGCCTGTGCAAGG + Intronic
1148502070 17:48099653-48099675 CAGTTTGGAAAGATTGTGAAAGG - Intronic
1148792269 17:50180122-50180144 CCCTTTGCAGAGGATGTGCAAGG - Intergenic
1149550208 17:57534205-57534227 CACTCTGCAAGCATTGTGCAAGG + Intronic
1150318135 17:64187219-64187241 CACTTTGTAAAGAATGTTCATGG + Intronic
1152125559 17:78444642-78444664 CACCATGCACAGCTTCTGCAGGG + Exonic
1152296678 17:79471322-79471344 CATTTTGCAAAGAGCGTGCAGGG + Intronic
1154202482 18:12308676-12308698 CACTTCCCAAAACTTGGGCAGGG - Exonic
1155271463 18:24145424-24145446 CACTTTCAAATTCTTGTGCAGGG + Intronic
1155527046 18:26727776-26727798 TAATTTCCAAAGCTTGTACAGGG - Intergenic
1156049332 18:32913274-32913296 CACTTTGCAAGGCTGAGGCAGGG + Intergenic
1157067236 18:44366453-44366475 CCCTTAGCAGAGCTTGAGCATGG + Intergenic
1157980610 18:52375633-52375655 AACTTTGTGAAGTTTGTGCAGGG + Intronic
1158997720 18:62940215-62940237 CACATTGCAAAGCTGGGGAATGG - Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1165022907 19:32938275-32938297 CACGTTGAAAAGCATGTGCTAGG + Intronic
1165482961 19:36076310-36076332 CACTTTGGAAGGCTGGGGCAGGG + Intronic
1166750017 19:45160130-45160152 GACTTTGTAATGTTTGTGCATGG + Exonic
927668946 2:25052789-25052811 CACTTTGCCCAGCCTGTGCCAGG + Intronic
932165970 2:69507420-69507442 GACTTTGCCAAGCTTGGGGAAGG - Exonic
934085410 2:88505165-88505187 CACTTTGCAAAGCTTATTGAAGG + Intergenic
936467196 2:112764306-112764328 CTCTTTGCAAGGCTGCTGCAGGG + Intronic
936514835 2:113174940-113174962 CACTTTTTAAAGCTGGTCCAAGG - Intronic
938653058 2:133403661-133403683 CACTTTGCAAAGGTGGTGACAGG - Intronic
938965393 2:136383788-136383810 GACTTTGCAAAGCTTTGGCGGGG + Intergenic
939663357 2:144918549-144918571 CACTTTGGAAAGCTAAGGCAGGG - Intergenic
940325544 2:152421479-152421501 CCCTTTGCAGAGCCTGTGGATGG - Intronic
940718320 2:157254239-157254261 CACATGGAAAAGCTTGTGTAAGG - Intergenic
941727240 2:168874823-168874845 CACTCTTGAAAGCTTGTGCCAGG + Intronic
942739868 2:179163600-179163622 AAGTTTGAAATGCTTGTGCAGGG - Intronic
943331693 2:186567372-186567394 CAAGTTGAAAAGCTTCTGCACGG + Intergenic
943578514 2:189658001-189658023 CACTTTGGAGCTCTTGTGCAGGG - Intergenic
946088185 2:217195616-217195638 AACATTGCAAAGCTTGTAGAAGG + Intergenic
946910351 2:224454628-224454650 CACTTTGCAAAGCTCTGGCTGGG + Intergenic
947027706 2:225756922-225756944 AAATTTGCAAACCTTGTACATGG + Intergenic
1168910737 20:1444703-1444725 CACCTAGCAAAGCCTCTGCATGG + Intronic
1168983974 20:2031805-2031827 TACTTTGATAAGCTTGTGGAGGG - Intergenic
1170113005 20:12825637-12825659 CAGTTTGCGAAGCCAGTGCAAGG - Intergenic
1170827223 20:19807144-19807166 AACCTTGTAAAGCTTGTGCTTGG + Intergenic
1172212714 20:33212358-33212380 CTCCTTGCAATGCTTGTGCCTGG + Intergenic
1174851448 20:53999346-53999368 ATCTTTGCCAAGATTGTGCAAGG + Intronic
1177632695 21:23747490-23747512 CACGTAGGAGAGCTTGTGCAGGG + Intergenic
1177874054 21:26609738-26609760 CACTTTGGAAAGCTGGAGGATGG - Intergenic
1178744448 21:35235083-35235105 TATTTTGCCAAGCTTGTGCTGGG + Intronic
1180824978 22:18855729-18855751 CACCGTGCCAAGGTTGTGCAGGG + Intronic
1180921540 22:19524058-19524080 CACTTTGCACTGCATGTGCCCGG + Exonic
1181187753 22:21118819-21118841 CACCGTGCCAAGGTTGTGCAGGG - Intergenic
1181211445 22:21291674-21291696 CACCGTGCCAAGGTTGTGCAGGG + Intergenic
1181398060 22:22635213-22635235 CACCGTGCCAAGGTTGTGCAGGG - Intergenic
1185395512 22:50585151-50585173 GACTTGGCTAAGTTTGTGCAGGG - Intronic
1203215503 22_KI270731v1_random:3757-3779 CACCGTGCCAAGGTTGTGCAGGG - Intergenic
1203275123 22_KI270734v1_random:81634-81656 CACCGTGCCAAGGTTGTGCAGGG + Intergenic
950951468 3:17004337-17004359 GACTCTGCAAAGCTAGGGCAGGG + Intronic
952529126 3:34245065-34245087 GGCTTTGCAAAGCTTGTAAAGGG - Intergenic
959007454 3:101036561-101036583 TACCTTGCAAGGCTTGTACAAGG + Intergenic
960911377 3:122652380-122652402 CAGCTATCAAAGCTTGTGCATGG - Intergenic
965724163 3:171696622-171696644 TACTTTGCAAAGCTAGTGTGTGG + Intronic
966885799 3:184377559-184377581 CTCTTTGCACAACTTGTGAAAGG - Intronic
967052824 3:185800491-185800513 CACTTTGCAAGGCTGAGGCAAGG + Intronic
967094196 3:186163249-186163271 CACTTTGGGAAGCTTGAGGAGGG - Intronic
967841285 3:194006835-194006857 CATTTTGCAGAGCCTCTGCAAGG + Intergenic
969418803 4:7077861-7077883 CACCTTGCAGAGCTGCTGCAGGG - Intergenic
969467372 4:7365818-7365840 CACTTTGCAAAGAAGGTGCCTGG - Intronic
970943742 4:21665743-21665765 CATTTGGCAAAACTTGTGCTGGG + Intronic
972867597 4:43253652-43253674 CACTGTGCAGAGCTTGTGTGAGG + Intergenic
973262903 4:48182582-48182604 CACTTTGCAAAGCTTGAAAATGG + Intronic
974135947 4:57818262-57818284 CACTTTGCAAAATATGTTCAAGG - Intergenic
976424817 4:84890398-84890420 TCCTTTTCAAAGCTTGGGCAAGG - Intronic
976756980 4:88509169-88509191 CACTCTGCAAAACTTCTGCAGGG + Intergenic
977176870 4:93829127-93829149 CACTTTGCAGGGCATCTGCACGG + Exonic
977529348 4:98181935-98181957 GACTTTTGAAAGCTTGTGCCTGG - Intergenic
979180550 4:117721436-117721458 CACTGTCCTAAGGTTGTGCAGGG - Intergenic
979849774 4:125561290-125561312 CAAGTTGAAAAGCTTCTGCACGG - Intergenic
980126007 4:128774908-128774930 CACTTAGCACAACTTTTGCAAGG - Intergenic
980372086 4:131888303-131888325 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
981517393 4:145624774-145624796 CACTCTGCAAAGCTTATGCAGGG + Intronic
982426267 4:155265183-155265205 CACTTTCCAAATATCGTGCAAGG + Intergenic
982485246 4:155958420-155958442 CACTTTGCTTGGCTTGTGCAAGG - Intergenic
985679522 5:1248698-1248720 CACATTGCCAAGGTTGTTCAGGG + Intergenic
986437093 5:7745162-7745184 CACTTTTCAGAGCTTTTGAAGGG - Intronic
992221697 5:74580007-74580029 CTCTTTGGAGAGCTTGGGCATGG - Intergenic
992440071 5:76790078-76790100 CCCTTTGCCTGGCTTGTGCAAGG - Intergenic
992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG + Intronic
993080725 5:83295839-83295861 TACTTTGGGAAGCTTTTGCAGGG + Intronic
998110194 5:139495497-139495519 CACTCTGCAGAGCTTGTACAGGG - Intergenic
998975723 5:147644602-147644624 CACTTTCCAAAGCTTGGAAATGG - Intronic
999021888 5:148174955-148174977 CATTTTGTAAATTTTGTGCAAGG + Intronic
999169401 5:149581039-149581061 GACTTGGCTAAGGTTGTGCAGGG + Intronic
1000934995 5:167296770-167296792 CTCTTTGCAGAGCTTTTGCAGGG - Intronic
1000951784 5:167492938-167492960 CATTTTGCCAAGCTTCTGCTTGG - Intronic
1003562796 6:7197091-7197113 CAGTTTGCAAAGCTTGTTCCAGG + Intronic
1004197877 6:13521616-13521638 CACTTTGCACAACTTGTACTTGG - Intergenic
1007867582 6:44989978-44990000 CACTCTAAAAAGCTTCTGCATGG - Intronic
1009751647 6:67884364-67884386 CAATTTGCAAATCTTGCGCAGGG + Intergenic
1010784991 6:79990788-79990810 CACTATGCAGATGTTGTGCATGG - Intergenic
1011997034 6:93603876-93603898 CACTTTGCCCAGTTTCTGCATGG - Intergenic
1012010136 6:93773575-93773597 CACTCTGCAGGCCTTGTGCAGGG + Intergenic
1012931044 6:105317201-105317223 CACTTTGAGAGGCTGGTGCAGGG - Intronic
1014196579 6:118566717-118566739 CTTTTTGAAAAGCTTGTGCTGGG - Intronic
1018402983 6:163444568-163444590 AAATTTACAAAGCTTTTGCAGGG + Intronic
1021578548 7:22128076-22128098 CCATTTGCGTAGCTTGTGCAAGG + Intronic
1023500415 7:40843932-40843954 CTCTTTGCAAGACTTGTGAAGGG + Intronic
1027998334 7:85456552-85456574 CTCTTTGCCAAGTTTGTTCATGG + Intergenic
1028270771 7:88786064-88786086 CACTTTGCCAAGCATCAGCAGGG - Intronic
1029316147 7:99716412-99716434 AATTTTCCAAAGCTTGAGCAGGG - Intronic
1029321810 7:99769002-99769024 AATTTTCCAAAGCTTGAGCAGGG - Intronic
1036108231 8:5866190-5866212 CACTTTTCTAAGTTTATGCACGG - Intergenic
1038236259 8:25759856-25759878 CACTTTGCAAATTTTCTACAAGG - Intergenic
1038664531 8:29526641-29526663 CCCTCTGCACAGCTTGTGTAAGG + Intergenic
1039527458 8:38229927-38229949 CACTTAGAATAGCTTCTGCAAGG - Intronic
1040120222 8:43675887-43675909 CACTTTGTAAAATTTGTGAAGGG + Intergenic
1040451002 8:47547215-47547237 CACTTTGCACAACTTGTACTTGG + Intronic
1040945367 8:52879352-52879374 CACTTAGCAAAGTTTTTTCAAGG + Intergenic
1041987813 8:63946997-63947019 CACTGTGCCCAGCTTGTGAAAGG + Intergenic
1043133639 8:76493018-76493040 CAAGTTGAAAAGCTTCTGCAAGG - Intergenic
1043868294 8:85400526-85400548 CACATTGCAAAGGGTGTGGAGGG + Intronic
1046882442 8:119324073-119324095 CTTTTTTAAAAGCTTGTGCAGGG - Intergenic
1049141721 8:140961201-140961223 CACTTTGCTAAGCTTATGGATGG + Intronic
1049542681 8:143215595-143215617 CATTCTCCAAAGCTGGTGCAGGG - Intergenic
1053636790 9:40015860-40015882 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
1053769199 9:41448754-41448776 CTCTTTGCAAAGCTGTTGAAGGG - Intergenic
1054317659 9:63612941-63612963 CTCTTTGCAAAGCTGTTGAAGGG + Intergenic
1054547870 9:66360255-66360277 CTCTTTGCAAAGCTGTTGAAGGG - Intergenic
1056682950 9:88735776-88735798 CACTTTGGAAAACTTCTCCATGG - Intergenic
1056921376 9:90792285-90792307 ACCTTTGTAAAGCTTGTGAAAGG - Intergenic
1057068579 9:92076737-92076759 CAATTTGCCAATCTTGAGCAGGG - Intronic
1058969134 9:110064101-110064123 CACCTTGCAAATCTTGTTGATGG + Intronic
1061332709 9:129906517-129906539 CATTCGGCAGAGCTTGTGCAAGG - Intronic
1061705835 9:132452389-132452411 CTCTTTGCAAAGCAGGGGCACGG - Intronic
1062155596 9:135046508-135046530 CACTTAGCAAACCAGGTGCATGG + Intergenic
1062262538 9:135670137-135670159 CCCTTTGCACAGCTTGTAAATGG + Intergenic
1185524659 X:767747-767769 CACATGTGAAAGCTTGTGCATGG - Intergenic
1185524691 X:768450-768472 CACATGTGAAAGCTTGTGCATGG - Intergenic
1187113927 X:16330165-16330187 TACTTTGCAGAGCTGTTGCAAGG + Intergenic
1188378130 X:29458079-29458101 CACTTTTCAAAGGATGTACAAGG - Intronic
1188537317 X:31211980-31212002 CATTTTGAAAAGCATATGCATGG - Intronic
1193534930 X:82702587-82702609 CACTTAGAAAACCTTGAGCATGG - Intergenic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1194507845 X:94754806-94754828 TACTTTCCCAAGCCTGTGCAGGG + Intergenic
1198656616 X:138921299-138921321 CACATTGCACAACTTCTGCATGG - Intronic
1199237244 X:145505657-145505679 CACTTTACAAAGCCCCTGCAAGG - Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200055019 X:153455744-153455766 TACTTTGCACAGCATGAGCAAGG - Exonic
1202391245 Y:24372714-24372736 CTCTTTGCCAAGCTTGTGCTTGG + Intergenic