ID: 1118452582

View in Genome Browser
Species Human (GRCh38)
Location 14:65917600-65917622
Sequence CTGTGGTTCCTGAGAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118452582_1118452588 20 Left 1118452582 14:65917600-65917622 CCCTCTTTTCTCAGGAACCACAG No data
Right 1118452588 14:65917643-65917665 CAAGAACTCATGAGCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118452582 Original CRISPR CTGTGGTTCCTGAGAAAAGA GGG (reversed) Intergenic
No off target data available for this crispr