ID: 1118452988

View in Genome Browser
Species Human (GRCh38)
Location 14:65920917-65920939
Sequence CAGGAATATCCAAGAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118452988_1118452991 -1 Left 1118452988 14:65920917-65920939 CCTGACTCTCTTGGATATTCCTG No data
Right 1118452991 14:65920939-65920961 GGATGTAATCCCCTGAGTCCTGG No data
1118452988_1118452992 0 Left 1118452988 14:65920917-65920939 CCTGACTCTCTTGGATATTCCTG No data
Right 1118452992 14:65920940-65920962 GATGTAATCCCCTGAGTCCTGGG No data
1118452988_1118452995 8 Left 1118452988 14:65920917-65920939 CCTGACTCTCTTGGATATTCCTG No data
Right 1118452995 14:65920948-65920970 CCCCTGAGTCCTGGGCAGGAAGG No data
1118452988_1118452993 4 Left 1118452988 14:65920917-65920939 CCTGACTCTCTTGGATATTCCTG No data
Right 1118452993 14:65920944-65920966 TAATCCCCTGAGTCCTGGGCAGG No data
1118452988_1118452999 26 Left 1118452988 14:65920917-65920939 CCTGACTCTCTTGGATATTCCTG No data
Right 1118452999 14:65920966-65920988 GAAGGTGCCGCATAGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118452988 Original CRISPR CAGGAATATCCAAGAGAGTC AGG (reversed) Intergenic
No off target data available for this crispr