ID: 1118452997

View in Genome Browser
Species Human (GRCh38)
Location 14:65920950-65920972
Sequence CACCTTCCTGCCCAGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118452997_1118453003 4 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453003 14:65920977-65920999 ATAGACACAAGGTAGATGGTGGG No data
1118452997_1118453007 28 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data
1118452997_1118453004 5 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453004 14:65920978-65921000 TAGACACAAGGTAGATGGTGGGG No data
1118452997_1118453006 27 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453006 14:65921000-65921022 GATGCTTATGGTCATTAGCATGG No data
1118452997_1118453002 3 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data
1118452997_1118453001 0 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453001 14:65920973-65920995 CCGCATAGACACAAGGTAGATGG No data
1118452997_1118452999 -7 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118452999 14:65920966-65920988 GAAGGTGCCGCATAGACACAAGG No data
1118452997_1118453005 15 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453005 14:65920988-65921010 GTAGATGGTGGGGATGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118452997 Original CRISPR CACCTTCCTGCCCAGGACTC AGG (reversed) Intergenic
No off target data available for this crispr