ID: 1118453002

View in Genome Browser
Species Human (GRCh38)
Location 14:65920976-65920998
Sequence CATAGACACAAGGTAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118452990_1118453002 17 Left 1118452990 14:65920936-65920958 CCTGGATGTAATCCCCTGAGTCC No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data
1118452994_1118453002 5 Left 1118452994 14:65920948-65920970 CCCCTGAGTCCTGGGCAGGAAGG No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data
1118452997_1118453002 3 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data
1118452998_1118453002 -4 Left 1118452998 14:65920957-65920979 CCTGGGCAGGAAGGTGCCGCATA No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data
1118452996_1118453002 4 Left 1118452996 14:65920949-65920971 CCCTGAGTCCTGGGCAGGAAGGT No data
Right 1118453002 14:65920976-65920998 CATAGACACAAGGTAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118453002 Original CRISPR CATAGACACAAGGTAGATGG TGG Intergenic
No off target data available for this crispr