ID: 1118453007

View in Genome Browser
Species Human (GRCh38)
Location 14:65921001-65921023
Sequence ATGCTTATGGTCATTAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118452997_1118453007 28 Left 1118452997 14:65920950-65920972 CCTGAGTCCTGGGCAGGAAGGTG No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data
1118452994_1118453007 30 Left 1118452994 14:65920948-65920970 CCCCTGAGTCCTGGGCAGGAAGG No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data
1118452998_1118453007 21 Left 1118452998 14:65920957-65920979 CCTGGGCAGGAAGGTGCCGCATA No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data
1118453000_1118453007 5 Left 1118453000 14:65920973-65920995 CCGCATAGACACAAGGTAGATGG No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data
1118452996_1118453007 29 Left 1118452996 14:65920949-65920971 CCCTGAGTCCTGGGCAGGAAGGT No data
Right 1118453007 14:65921001-65921023 ATGCTTATGGTCATTAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118453007 Original CRISPR ATGCTTATGGTCATTAGCAT GGG Intergenic
No off target data available for this crispr