ID: 1118453354

View in Genome Browser
Species Human (GRCh38)
Location 14:65924087-65924109
Sequence CTCCTAAGTGATTCGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118453354_1118453358 5 Left 1118453354 14:65924087-65924109 CCCTCCTACGAATCACTTAGGAG No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118453354 Original CRISPR CTCCTAAGTGATTCGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr