ID: 1118453358

View in Genome Browser
Species Human (GRCh38)
Location 14:65924115-65924137
Sequence TGTTATCTGATCAAGTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118453351_1118453358 21 Left 1118453351 14:65924071-65924093 CCATGCTCTGCATGTCCCCTCCT No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data
1118453354_1118453358 5 Left 1118453354 14:65924087-65924109 CCCTCCTACGAATCACTTAGGAG No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data
1118453355_1118453358 4 Left 1118453355 14:65924088-65924110 CCTCCTACGAATCACTTAGGAGC No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data
1118453356_1118453358 1 Left 1118453356 14:65924091-65924113 CCTACGAATCACTTAGGAGCTGG No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data
1118453353_1118453358 6 Left 1118453353 14:65924086-65924108 CCCCTCCTACGAATCACTTAGGA No data
Right 1118453358 14:65924115-65924137 TGTTATCTGATCAAGTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118453358 Original CRISPR TGTTATCTGATCAAGTGTCA AGG Intergenic
No off target data available for this crispr