ID: 1118454490

View in Genome Browser
Species Human (GRCh38)
Location 14:65932152-65932174
Sequence TGCCCAGGGGAAGTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118454490_1118454500 24 Left 1118454490 14:65932152-65932174 CCCCAAGACACTTCCCCTGGGCA No data
Right 1118454500 14:65932199-65932221 TTTTTTCCTGTGGGAGCATCTGG No data
1118454490_1118454498 15 Left 1118454490 14:65932152-65932174 CCCCAAGACACTTCCCCTGGGCA No data
Right 1118454498 14:65932190-65932212 AGCTTCTCCTTTTTTCCTGTGGG No data
1118454490_1118454497 14 Left 1118454490 14:65932152-65932174 CCCCAAGACACTTCCCCTGGGCA No data
Right 1118454497 14:65932189-65932211 CAGCTTCTCCTTTTTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118454490 Original CRISPR TGCCCAGGGGAAGTGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr