ID: 1118456287

View in Genome Browser
Species Human (GRCh38)
Location 14:65948044-65948066
Sequence AGGTGTGCTGAGCTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118456287_1118456291 -3 Left 1118456287 14:65948044-65948066 CCTGGGGAGAGCTCAGCACACCT No data
Right 1118456291 14:65948064-65948086 CCTCATGTCACAGGCTGGACTGG No data
1118456287_1118456289 -8 Left 1118456287 14:65948044-65948066 CCTGGGGAGAGCTCAGCACACCT No data
Right 1118456289 14:65948059-65948081 GCACACCTCATGTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118456287 Original CRISPR AGGTGTGCTGAGCTCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr