ID: 1118456291

View in Genome Browser
Species Human (GRCh38)
Location 14:65948064-65948086
Sequence CCTCATGTCACAGGCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118456283_1118456291 26 Left 1118456283 14:65948015-65948037 CCAGGCAGGACTGCTGAAGGGTA No data
Right 1118456291 14:65948064-65948086 CCTCATGTCACAGGCTGGACTGG No data
1118456287_1118456291 -3 Left 1118456287 14:65948044-65948066 CCTGGGGAGAGCTCAGCACACCT No data
Right 1118456291 14:65948064-65948086 CCTCATGTCACAGGCTGGACTGG No data
1118456282_1118456291 27 Left 1118456282 14:65948014-65948036 CCCAGGCAGGACTGCTGAAGGGT No data
Right 1118456291 14:65948064-65948086 CCTCATGTCACAGGCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118456291 Original CRISPR CCTCATGTCACAGGCTGGAC TGG Intergenic