ID: 1118463868

View in Genome Browser
Species Human (GRCh38)
Location 14:66013615-66013637
Sequence CGCAACGAAGGTTTTGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463868_1118463878 19 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data
1118463868_1118463873 3 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463868_1118463872 -1 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463872 14:66013637-66013659 GATGACCTTTTTGTGCCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 60
1118463868_1118463879 27 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463868_1118463881 28 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463868 Original CRISPR CGCAACGAAGGTTTTGGGAA CGG (reversed) Intergenic
913045011 1:115066773-115066795 TGCAACTTAGTTTTTGGGAAGGG + Intronic
915313913 1:155017596-155017618 CGCAGCGAAGGGTGTGGGACAGG + Exonic
916463284 1:165048271-165048293 GGCAAAGAAGGTTTAGGGGAGGG - Intergenic
918582151 1:186144211-186144233 TGCAGCGAAAGTTGTGGGAAAGG + Exonic
919490165 1:198196842-198196864 TGCAAGGAAGAGTTTGGGAATGG + Intronic
920513803 1:206569324-206569346 GGCAACACAGGTTTTGGGAGGGG + Intronic
922675861 1:227548737-227548759 CCCAACAAAAGTTTTGGGAAAGG - Intergenic
1071798258 10:89029109-89029131 CGAAACGAAGGTCTTGCTAAAGG + Intergenic
1082606906 11:55248713-55248735 CGCAAAGAAGTTACTGGGAATGG + Intergenic
1086062374 11:82713127-82713149 AGAAAAGAAGGTTTTGTGAATGG + Intergenic
1089866952 11:121640799-121640821 CGCAAAGGAGGCTTTGGGATGGG + Intergenic
1093590278 12:20894681-20894703 CTCAAAGGAGATTTTGGGAAGGG - Intronic
1094096130 12:26706847-26706869 CCCAAGGAAGGTGTTGTGAAAGG - Intronic
1103163849 12:118753409-118753431 CTTAGTGAAGGTTTTGGGAATGG + Intergenic
1109778157 13:67071407-67071429 CCCTACCAAGGTTTTGGCAAAGG - Intronic
1112049022 13:95626970-95626992 TGCAAAGAAGGTTATTGGAATGG - Intronic
1113135275 13:107081993-107082015 AGCAAGGAAGGGTATGGGAAGGG + Intergenic
1113135282 13:107082014-107082036 GGCAAGGAAGGGTATGGGAAGGG + Intergenic
1118463868 14:66013615-66013637 CGCAACGAAGGTTTTGGGAACGG - Intergenic
1118841469 14:69516618-69516640 AGCAATGAAGGTTTTGAGCAGGG + Intronic
1121621421 14:95352015-95352037 CCCAAGGAAGCTTTTGGGGATGG - Intergenic
1135943259 16:26841206-26841228 CCCAACAAATGTTTTGGAAAGGG + Intergenic
1137879401 16:52031061-52031083 AGGAACAAAGGATTTGGGAATGG + Intronic
1147212427 17:38879686-38879708 AGCAAGGAAGGTTTGGGGTAAGG - Intronic
1147312773 17:39605132-39605154 CTCAGCGAAGATATTGGGAATGG + Exonic
1151250078 17:72827598-72827620 CACCAGGAAGGCTTTGGGAAGGG + Intronic
1153273614 18:3347435-3347457 CACAAAGAAGGATTTGGGAGGGG - Intergenic
1154311864 18:13273173-13273195 AGCAAGGTTGGTTTTGGGAAGGG + Intronic
1160416937 18:78718120-78718142 CCCCACCAAGGTTTTGGGGAGGG + Intergenic
1164668386 19:30058519-30058541 CTGAAGGAATGTTTTGGGAATGG + Intergenic
1168445496 19:56408766-56408788 GGCAATGAAGGTTCTGGGCATGG - Intronic
926368436 2:12155481-12155503 TGCAAAGAAGGCGTTGGGAATGG - Intergenic
935825060 2:106938044-106938066 CAAAAGGAAAGTTTTGGGAAAGG - Intergenic
943809259 2:192163846-192163868 CGCAAAGAAGGATATGGAAAAGG - Intronic
949017980 2:241724338-241724360 TGCACCGAGGGTTTTGAGAAGGG + Intronic
1171575355 20:26305902-26305924 CACAAAGAAGTTTTTGAGAATGG - Intergenic
955009991 3:55004533-55004555 GGGAACGAAGGTATTGGAAAGGG - Intronic
955418016 3:58710812-58710834 CGAAAGGAAGGTGTTGTGAATGG + Intergenic
955744417 3:62125884-62125906 AGACAAGAAGGTTTTGGGAAAGG - Intronic
958211280 3:90480917-90480939 CACAAAGAAGTTTCTGGGAATGG + Intergenic
971170913 4:24231557-24231579 GGCAACAAAGGTTTCCGGAAGGG + Intergenic
975581220 4:75908551-75908573 CGCTAGTAAAGTTTTGGGAAGGG + Intergenic
985546029 5:509633-509655 CGCAAGCTTGGTTTTGGGAATGG - Intronic
990053479 5:51538656-51538678 CCCATCGAAGGTTCTAGGAAAGG - Intergenic
1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG + Exonic
1007396841 6:41582867-41582889 CGCAGGGCAGGTCTTGGGAAGGG - Intronic
1015128185 6:129777706-129777728 CACAGCAAAGGCTTTGGGAATGG + Intergenic
1016715172 6:147218122-147218144 GGCTACGAATGTTTTGGGACAGG - Intronic
1019877715 7:3829564-3829586 AGAAACGAGGGTTTTGGGAGGGG - Intronic
1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG + Exonic
1026645125 7:72160872-72160894 TGGAAGGAAGATTTTGGGAATGG - Intronic
1028191938 7:87863854-87863876 GGCCAGGAAGGTTTTGGGGAAGG - Intronic
1029163574 7:98570169-98570191 CGGAAGAAAGGTTTGGGGAAGGG + Intergenic
1032893070 7:136220609-136220631 CTCAGCGAGGCTTTTGGGAAGGG + Intergenic
1039768627 8:40659727-40659749 AGAAACGAAGGTGTTGGGATAGG - Intronic
1040141429 8:43921102-43921124 CACAACGTAGTTTTTGAGAATGG - Intergenic
1042930538 8:74008928-74008950 ACCAAAGAAGGTTTAGGGAAAGG + Intronic
1049750411 8:144280471-144280493 CTCAGCGAAGGCTCTGGGAATGG - Intronic
1055968985 9:81892898-81892920 GGCAAAGGAGGTTTTGGGGAAGG - Intergenic
1185838247 X:3365609-3365631 CTCAATGAAGGTTTCTGGAATGG - Intergenic
1190159463 X:48020736-48020758 AGCACCGACGGCTTTGGGAACGG - Intronic
1191715851 X:64193036-64193058 CGGAGCAAAGGTTCTGGGAAAGG - Exonic
1191791449 X:64976275-64976297 CGCAACGAAGGGTTGGAGAGGGG + Intronic
1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG + Intergenic
1197351536 X:125388745-125388767 GGCAAAGCAGGTTATGGGAATGG + Intergenic
1201237600 Y:11926088-11926110 CTCAATGAAGGTTTCTGGAATGG + Intergenic