ID: 1118463868

View in Genome Browser
Species Human (GRCh38)
Location 14:66013615-66013637
Sequence CGCAACGAAGGTTTTGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463868_1118463873 3 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463868_1118463872 -1 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463872 14:66013637-66013659 GATGACCTTTTTGTGCCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 60
1118463868_1118463881 28 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463868_1118463879 27 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463868_1118463878 19 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463868 Original CRISPR CGCAACGAAGGTTTTGGGAA CGG (reversed) Intergenic