ID: 1118463869

View in Genome Browser
Species Human (GRCh38)
Location 14:66013620-66013642
Sequence GTCATCGCAACGAAGGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463869_1118463879 22 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463869_1118463873 -2 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463869_1118463878 14 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data
1118463869_1118463881 23 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463869_1118463872 -6 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463872 14:66013637-66013659 GATGACCTTTTTGTGCCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463869 Original CRISPR GTCATCGCAACGAAGGTTTT GGG (reversed) Intergenic