ID: 1118463870

View in Genome Browser
Species Human (GRCh38)
Location 14:66013621-66013643
Sequence GGTCATCGCAACGAAGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463870_1118463873 -3 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463870_1118463881 22 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463870_1118463879 21 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463870_1118463878 13 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data
1118463870_1118463872 -7 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463872 14:66013637-66013659 GATGACCTTTTTGTGCCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463870 Original CRISPR GGTCATCGCAACGAAGGTTT TGG (reversed) Intergenic
No off target data available for this crispr