ID: 1118463871

View in Genome Browser
Species Human (GRCh38)
Location 14:66013627-66013649
Sequence CAAAAAGGTCATCGCAACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463871_1118463881 16 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463871_1118463878 7 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data
1118463871_1118463879 15 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463871_1118463873 -9 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463871 Original CRISPR CAAAAAGGTCATCGCAACGA AGG (reversed) Intergenic
904353594 1:29924513-29924535 CAAAAAGGTCAGCGTAACCAGGG - Intergenic
921972887 1:221169598-221169620 CAAAGATGTCATCCCAACAAAGG - Intergenic
1065030986 10:21585657-21585679 CAAAAAGGTCCTCTCAACACAGG - Intronic
1072526254 10:96274209-96274231 CAAAAAGGTTAATGCAAAGATGG + Intergenic
1075003416 10:118814082-118814104 CAATAAGGTCAGCACAACTAAGG - Intergenic
1076011210 10:126990168-126990190 CAAAAAGGTGATCCCAACAGGGG - Intronic
1078200282 11:9176075-9176097 CCAAAAGGTCATCTTAATGAGGG - Intronic
1107583857 13:41822550-41822572 CAAAAAGTTAATAGCAATGATGG - Intronic
1109269132 13:60234858-60234880 CAAATAGGGCATTGCAACGTGGG - Intergenic
1118463871 14:66013627-66013649 CAAAAAGGTCATCGCAACGAAGG - Intergenic
1127855884 15:62953313-62953335 CAAGAAAGTCATCGCAACGAAGG + Intergenic
1135209039 16:20508331-20508353 CAAAAAGGTCAAAGCAACTTTGG - Intergenic
1138132543 16:54493157-54493179 CAAAAACCTCATCCCAAAGAAGG + Intergenic
1143830099 17:9644834-9644856 CAGAGAGGTTATCGCAACGTAGG - Intronic
938562743 2:132489259-132489281 GGAAAAGGTCATTGCAAGGAAGG - Intronic
1170250855 20:14280766-14280788 CAATAACGTCATCCCAAAGAGGG - Intronic
952617698 3:35294775-35294797 CAAAGAGGTAAACGCAAAGATGG + Intergenic
962105764 3:132387319-132387341 CAAAGATGTCATTGCAAAGAAGG + Intergenic
974392267 4:61287451-61287473 AAAAAAAGTGTTCGCAACGAGGG + Intronic
975698420 4:77037814-77037836 CAAAAAGGGCATTTCAACAATGG + Exonic
985032319 4:185801786-185801808 CAAAAAGTTCATCTCAAAGTTGG + Intronic
994073216 5:95623646-95623668 TAGAAAGGTCATCTCAATGATGG + Intergenic
1011847855 6:91589332-91589354 CAAAAAGGACCTCTCAAAGAGGG - Intergenic
1012911475 6:105122690-105122712 TAAAAAGGTCACAGCAAAGAAGG + Intronic
1024189253 7:46988740-46988762 CAAAAAAGTCATCACAATGGAGG + Intergenic
1030055809 7:105583051-105583073 CAAGAAGGTCATCGCAGTGAAGG - Intronic
1031124214 7:117755402-117755424 TAAAAAGGTCATCGAAATTAAGG + Intronic
1033469286 7:141629909-141629931 CAAAAATGTCCTCCCAAAGAAGG + Intronic
1034481827 7:151327451-151327473 CAAAAAGTTTATGGCAACAATGG - Intergenic
1040351536 8:46573487-46573509 AAAAAAGGTCATCGTAATGGTGG + Intergenic
1053181217 9:35972143-35972165 CAAGAAGGTCATCGCAACGAAGG - Intergenic
1058912529 9:109534155-109534177 CAAGAAGGTCATCGCAACGAAGG - Intergenic
1186870650 X:13767872-13767894 CAAATATGTCATCTCAATGAAGG - Intronic
1201857698 Y:18563727-18563749 CAAATAGGTCATCTCAATGAAGG + Intronic
1201875623 Y:18756654-18756676 CAAATAGGTCATCTCAATGAAGG - Intronic
1202167379 Y:22004340-22004362 CAAATAGATCATCTCAATGAAGG - Intergenic
1202169319 Y:22024280-22024302 CAAATAGGTCATCTCAATGAAGG - Intergenic
1202222043 Y:22562085-22562107 CAAATAGGTCATCTCAATGAAGG + Intergenic
1202223981 Y:22582029-22582051 CAAATAGATCATCTCAATGAAGG + Intergenic
1202319134 Y:23613632-23613654 CAAATAGATCATCTCAATGAAGG - Intergenic
1202321072 Y:23633582-23633604 CAAATAGGTCATCTCAATGAAGG - Intergenic
1202549695 Y:26036474-26036496 CAAATAGGTCATCTCAATGAAGG + Intergenic
1202551635 Y:26056425-26056447 CAAATAGATCATCTCAATGAAGG + Intergenic