ID: 1118463873

View in Genome Browser
Species Human (GRCh38)
Location 14:66013641-66013663
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 3, 3: 2, 4: 20}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463865_1118463873 28 Left 1118463865 14:66013590-66013612 CCGTTCCTTACATTGAACCATTT No data
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463867_1118463873 11 Left 1118463867 14:66013607-66013629 CCATTTTACCGTTCCCAAAACCT 0: 1
1: 6
2: 3
3: 14
4: 742
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463870_1118463873 -3 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463868_1118463873 3 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463871_1118463873 -9 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463866_1118463873 23 Left 1118463866 14:66013595-66013617 CCTTACATTGAACCATTTTACCG 0: 1
1: 3
2: 1
3: 5
4: 83
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20
1118463869_1118463873 -2 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463873 14:66013641-66013663 ACCTTTTTGTGCCCGCCGGCAGG 0: 1
1: 0
2: 3
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463873 Original CRISPR ACCTTTTTGTGCCCGCCGGC AGG Intergenic