ID: 1118463874

View in Genome Browser
Species Human (GRCh38)
Location 14:66013642-66013664
Sequence GCCTGCCGGCGGGCACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463874_1118463879 0 Left 1118463874 14:66013642-66013664 CCTTTTTGTGCCCGCCGGCAGGC 0: 1
1: 0
2: 2
3: 3
4: 37
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463874_1118463878 -8 Left 1118463874 14:66013642-66013664 CCTTTTTGTGCCCGCCGGCAGGC 0: 1
1: 0
2: 2
3: 3
4: 37
Right 1118463878 14:66013657-66013679 CGGCAGGCGCCGCCGATGTGAGG No data
1118463874_1118463881 1 Left 1118463874 14:66013642-66013664 CCTTTTTGTGCCCGCCGGCAGGC 0: 1
1: 0
2: 2
3: 3
4: 37
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463874_1118463887 26 Left 1118463874 14:66013642-66013664 CCTTTTTGTGCCCGCCGGCAGGC 0: 1
1: 0
2: 2
3: 3
4: 37
Right 1118463887 14:66013691-66013713 ACCGCTCCCTGCGCCGCTGCCGG 0: 1
1: 1
2: 1
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463874 Original CRISPR GCCTGCCGGCGGGCACAAAA AGG (reversed) Intergenic
900329950 1:2129078-2129100 CCCTGCCTGCGGGCCCAGAAAGG + Intronic
906027060 1:42682703-42682725 GCCTGCCGGCGGGGACAAGAAGG + Exonic
907636147 1:56136287-56136309 GCCTGCTGGAGGGCACAACCTGG - Intergenic
1065968552 10:30787739-30787761 GCCTGACAACGGGGACAAAATGG + Intergenic
1077918673 11:6627024-6627046 GCCTGCCAGCCGGTACAGAATGG + Exonic
1091743772 12:2977878-2977900 GCCTGCCGGAGGCCAAAAAAGGG - Intronic
1095561582 12:43572132-43572154 GCCTGCCGGCCGGCTCATCAGGG + Intergenic
1118463874 14:66013642-66013664 GCCTGCCGGCGGGCACAAAAAGG - Intergenic
1120554904 14:85917896-85917918 GCCTTCCAGCGGGGACCAAAAGG + Intergenic
1128359677 15:66953217-66953239 GCCTGCCCATGGGCACACAAGGG - Intergenic
1131065257 15:89430709-89430731 GCCTGGCGGGGGGCTCACAATGG - Intergenic
1131231781 15:90665255-90665277 GCCTGCCCCCGGCCACAACAAGG - Intergenic
1133106436 16:3513040-3513062 GTCTGCCAGTGGGCACAACAAGG - Intronic
1145327533 17:21843699-21843721 CCATGGCGGCGGGGACAAAAAGG - Intergenic
1148772891 17:50077119-50077141 GCCGGCCGGCGGGCACTCACGGG - Exonic
1159530348 18:69647869-69647891 CCCTGCCGGCGGGCAGAGAAAGG - Intronic
1160559601 18:79747781-79747803 GCGTGGCCGCGGGAACAAAAGGG - Intronic
1167873401 19:52391758-52391780 GCCTGCCGTCTGGCAGAATAAGG - Intergenic
925676695 2:6369385-6369407 GCCTGAGGGAGGGCACAAGATGG - Intergenic
931856376 2:66305999-66306021 GCCAGCTGGCGGTCACACAAAGG - Intergenic
1173329514 20:42062681-42062703 GCCTGCCTGCAGGGAAAAAAAGG - Intergenic
1173698905 20:45048942-45048964 GCCTCCAGGCAGGCACAGAAGGG - Intronic
1182877714 22:33706775-33706797 ACCTGCCTGAGGGCAGAAAAGGG - Intronic
949516083 3:4808086-4808108 GCCTGACGCAGGGCACATAATGG + Intronic
959005658 3:101016641-101016663 GCCTGCGGGAGGACAGAAAATGG + Intergenic
961452752 3:127009725-127009747 GCATGCAGGCAGGCACAAGAAGG - Intronic
964397368 3:156259437-156259459 GTCTGCCAGCGGGCAGCAAAAGG + Intronic
966422230 3:179745126-179745148 GCCTGAAGGCAGGCACTAAATGG - Exonic
985784144 5:1885497-1885519 GCCTGCTGGCGGGCAGGAAGTGG - Intronic
991999043 5:72417626-72417648 GCCTGCCCGCGAGGACAAGAAGG + Intergenic
1002762043 6:209757-209779 GCCTGCCGGTGCGCAGGAAAAGG + Intergenic
1004434458 6:15577173-15577195 GCCTGCTGGAGGGAGCAAAATGG + Intronic
1006574138 6:35031545-35031567 CCCTGGCGACTGGCACAAAATGG - Intronic
1019810467 7:3161604-3161626 TCCTGGCAGCGGCCACAAAATGG + Intronic
1026459837 7:70604252-70604274 GCCTGGAGGAGAGCACAAAATGG - Intronic
1030055812 7:105583066-105583088 GCCTGCCAGCGTGGACAAGAAGG - Intronic
1037817347 8:22119163-22119185 GCCTGGCACCGGGCACAGAAAGG - Exonic
1048510901 8:135061457-135061479 ACCTGCTGCCGGCCACAAAAGGG - Intergenic
1051343103 9:16129256-16129278 GCCAGCCTGCTGGCACTAAAAGG + Intergenic
1053181220 9:35972158-35972180 GCCTGCCGGCGGGGACAAGAAGG - Intergenic
1058912532 9:109534170-109534192 ACCTGCCGGCGGGGACAAGAAGG - Intergenic
1185556876 X:1028612-1028634 GTCTTCCTGCGGGCACGAAAAGG + Intergenic
1192456890 X:71283594-71283616 GCCTGCCAAGGGGTACAAAATGG - Exonic