ID: 1118463875

View in Genome Browser
Species Human (GRCh38)
Location 14:66013652-66013674
Sequence CATCGGCGGCGCCTGCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463875_1118463881 -9 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463875_1118463879 -10 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463879 14:66013665-66013687 GCCGCCGATGTGAGGCCGCCCGG No data
1118463875_1118463891 25 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463891 14:66013700-66013722 TGCGCCGCTGCCGGTAGTGCCGG 0: 1
1: 2
2: 4
3: 2
4: 42
1118463875_1118463892 26 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463892 14:66013701-66013723 GCGCCGCTGCCGGTAGTGCCGGG 0: 1
1: 2
2: 2
3: 11
4: 61
1118463875_1118463887 16 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463887 14:66013691-66013713 ACCGCTCCCTGCGCCGCTGCCGG 0: 1
1: 1
2: 1
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463875 Original CRISPR CATCGGCGGCGCCTGCCGGC GGG (reversed) Intergenic
No off target data available for this crispr