ID: 1118463876

View in Genome Browser
Species Human (GRCh38)
Location 14:66013653-66013675
Sequence ACATCGGCGGCGCCTGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463876_1118463894 30 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463894 14:66013706-66013728 GCTGCCGGTAGTGCCGGGCTTGG 0: 1
1: 3
2: 1
3: 2
4: 114
1118463876_1118463887 15 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463887 14:66013691-66013713 ACCGCTCCCTGCGCCGCTGCCGG 0: 1
1: 1
2: 1
3: 13
4: 182
1118463876_1118463881 -10 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463876_1118463891 24 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463891 14:66013700-66013722 TGCGCCGCTGCCGGTAGTGCCGG 0: 1
1: 2
2: 4
3: 2
4: 42
1118463876_1118463892 25 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463892 14:66013701-66013723 GCGCCGCTGCCGGTAGTGCCGGG 0: 1
1: 2
2: 2
3: 11
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463876 Original CRISPR ACATCGGCGGCGCCTGCCGG CGG (reversed) Intergenic
No off target data available for this crispr