ID: 1118463881

View in Genome Browser
Species Human (GRCh38)
Location 14:66013666-66013688
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118463869_1118463881 23 Left 1118463869 14:66013620-66013642 CCCAAAACCTTCGTTGCGATGAC No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463871_1118463881 16 Left 1118463871 14:66013627-66013649 CCTTCGTTGCGATGACCTTTTTG 0: 1
1: 2
2: 1
3: 8
4: 31
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463868_1118463881 28 Left 1118463868 14:66013615-66013637 CCGTTCCCAAAACCTTCGTTGCG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463874_1118463881 1 Left 1118463874 14:66013642-66013664 CCTTTTTGTGCCCGCCGGCAGGC 0: 1
1: 0
2: 2
3: 3
4: 37
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463876_1118463881 -10 Left 1118463876 14:66013653-66013675 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463870_1118463881 22 Left 1118463870 14:66013621-66013643 CCAAAACCTTCGTTGCGATGACC No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data
1118463875_1118463881 -9 Left 1118463875 14:66013652-66013674 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118463881 Original CRISPR CCGCCGATGTGAGGCCGCCC GGG Intergenic