ID: 1118468906

View in Genome Browser
Species Human (GRCh38)
Location 14:66056815-66056837
Sequence CCTTCCTCTGGGGGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118468906_1118468926 25 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468926 14:66056863-66056885 TGGGGGAGAAAGGTGCCTAGGGG No data
1118468906_1118468919 6 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468919 14:66056844-66056866 GAAAAGATATCCAGTGTTCTGGG No data
1118468906_1118468918 5 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468918 14:66056843-66056865 GGAAAAGATATCCAGTGTTCTGG No data
1118468906_1118468921 8 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468921 14:66056846-66056868 AAAGATATCCAGTGTTCTGGGGG No data
1118468906_1118468925 24 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468925 14:66056862-66056884 CTGGGGGAGAAAGGTGCCTAGGG No data
1118468906_1118468920 7 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468920 14:66056845-66056867 AAAAGATATCCAGTGTTCTGGGG No data
1118468906_1118468927 26 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468927 14:66056864-66056886 GGGGGAGAAAGGTGCCTAGGGGG No data
1118468906_1118468928 30 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468928 14:66056868-66056890 GAGAAAGGTGCCTAGGGGGATGG No data
1118468906_1118468922 15 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468922 14:66056853-66056875 TCCAGTGTTCTGGGGGAGAAAGG No data
1118468906_1118468924 23 Left 1118468906 14:66056815-66056837 CCACCCAGCCCCCCAGAGGAAGG No data
Right 1118468924 14:66056861-66056883 TCTGGGGGAGAAAGGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118468906 Original CRISPR CCTTCCTCTGGGGGGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr