ID: 1118473451

View in Genome Browser
Species Human (GRCh38)
Location 14:66095323-66095345
Sequence TGTGCTCAGACACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118473451_1118473459 19 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473459 14:66095365-66095387 CCACATAGTTGGGGGCTCAATGG No data
1118473451_1118473457 11 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473457 14:66095357-66095379 GAAGATATCCACATAGTTGGGGG No data
1118473451_1118473454 8 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473454 14:66095354-66095376 GAGGAAGATATCCACATAGTTGG No data
1118473451_1118473456 10 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473456 14:66095356-66095378 GGAAGATATCCACATAGTTGGGG No data
1118473451_1118473460 27 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473460 14:66095373-66095395 TTGGGGGCTCAATGGCAGCCTGG No data
1118473451_1118473455 9 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473455 14:66095355-66095377 AGGAAGATATCCACATAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118473451 Original CRISPR TGTGCTCAGACACCCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr