ID: 1118473460

View in Genome Browser
Species Human (GRCh38)
Location 14:66095373-66095395
Sequence TTGGGGGCTCAATGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118473451_1118473460 27 Left 1118473451 14:66095323-66095345 CCTGCTTGGGGTGTCTGAGCACA No data
Right 1118473460 14:66095373-66095395 TTGGGGGCTCAATGGCAGCCTGG No data
1118473450_1118473460 28 Left 1118473450 14:66095322-66095344 CCCTGCTTGGGGTGTCTGAGCAC No data
Right 1118473460 14:66095373-66095395 TTGGGGGCTCAATGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118473460 Original CRISPR TTGGGGGCTCAATGGCAGCC TGG Intergenic
No off target data available for this crispr