ID: 1118474849

View in Genome Browser
Species Human (GRCh38)
Location 14:66106914-66106936
Sequence TCGGAGGCCAAGAACTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118474844_1118474849 27 Left 1118474844 14:66106864-66106886 CCAAGGATGGGGTTTAAGATAGA No data
Right 1118474849 14:66106914-66106936 TCGGAGGCCAAGAACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118474849 Original CRISPR TCGGAGGCCAAGAACTATGA AGG Intergenic
No off target data available for this crispr