ID: 1118475462

View in Genome Browser
Species Human (GRCh38)
Location 14:66112142-66112164
Sequence CCCAGCGTGACTCCCGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118475458_1118475462 3 Left 1118475458 14:66112116-66112138 CCAAGGTGCACGCCTGCCTCATG No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475456_1118475462 13 Left 1118475456 14:66112106-66112128 CCTAGCCAATCCAAGGTGCACGC No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475455_1118475462 14 Left 1118475455 14:66112105-66112127 CCCTAGCCAATCCAAGGTGCACG No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475452_1118475462 20 Left 1118475452 14:66112099-66112121 CCTCCACCCTAGCCAATCCAAGG No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475459_1118475462 -9 Left 1118475459 14:66112128-66112150 CCTGCCTCATGCAGCCCAGCGTG No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475454_1118475462 17 Left 1118475454 14:66112102-66112124 CCACCCTAGCCAATCCAAGGTGC No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data
1118475457_1118475462 8 Left 1118475457 14:66112111-66112133 CCAATCCAAGGTGCACGCCTGCC No data
Right 1118475462 14:66112142-66112164 CCCAGCGTGACTCCCGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118475462 Original CRISPR CCCAGCGTGACTCCCGCCAT TGG Intergenic
No off target data available for this crispr