ID: 1118477997

View in Genome Browser
Species Human (GRCh38)
Location 14:66136313-66136335
Sequence CATTAACCCCTCCTGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118477993_1118477997 -3 Left 1118477993 14:66136293-66136315 CCGCTGGAAGCCGAGCAAGGCAT No data
Right 1118477997 14:66136313-66136335 CATTAACCCCTCCTGGGCGCAGG No data
1118477990_1118477997 23 Left 1118477990 14:66136267-66136289 CCAGACTTCTAAGTACAGGAGTG No data
Right 1118477997 14:66136313-66136335 CATTAACCCCTCCTGGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118477997 Original CRISPR CATTAACCCCTCCTGGGCGC AGG Intergenic
No off target data available for this crispr