ID: 1118482323

View in Genome Browser
Species Human (GRCh38)
Location 14:66179718-66179740
Sequence GAGGGAAATTAGAGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118482323_1118482333 29 Left 1118482323 14:66179718-66179740 CCAGCACCCCTCTAATTTCCCTC No data
Right 1118482333 14:66179770-66179792 CCTTTTTCAGTATTCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118482323 Original CRISPR GAGGGAAATTAGAGGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr