ID: 1118483201

View in Genome Browser
Species Human (GRCh38)
Location 14:66188255-66188277
Sequence GCAGCCCAACATTCAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483201_1118483203 -9 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483203 14:66188269-66188291 TTGGGCTGCCTTGCTAGATTGGG No data
1118483201_1118483208 20 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483208 14:66188298-66188320 CTCCTGGATAATGTCCTGCAGGG No data
1118483201_1118483206 4 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483206 14:66188282-66188304 CTAGATTGGGGAAGTTCTCCTGG No data
1118483201_1118483204 -8 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483204 14:66188270-66188292 TGGGCTGCCTTGCTAGATTGGGG No data
1118483201_1118483202 -10 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483202 14:66188268-66188290 GTTGGGCTGCCTTGCTAGATTGG No data
1118483201_1118483207 19 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483201 Original CRISPR GCAGCCCAACATTCAGATTC AGG (reversed) Intergenic