ID: 1118483201

View in Genome Browser
Species Human (GRCh38)
Location 14:66188255-66188277
Sequence GCAGCCCAACATTCAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11025
Summary {0: 6, 1: 1557, 2: 4693, 3: 2991, 4: 1778}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483201_1118483207 19 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG No data
1118483201_1118483204 -8 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483204 14:66188270-66188292 TGGGCTGCCTTGCTAGATTGGGG 0: 19
1: 3996
2: 2664
3: 2314
4: 1650
1118483201_1118483208 20 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483208 14:66188298-66188320 CTCCTGGATAATGTCCTGCAGGG No data
1118483201_1118483206 4 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483206 14:66188282-66188304 CTAGATTGGGGAAGTTCTCCTGG 0: 3911
1: 3544
2: 2187
3: 1132
4: 656
1118483201_1118483203 -9 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483203 14:66188269-66188291 TTGGGCTGCCTTGCTAGATTGGG 0: 19
1: 4039
2: 2715
3: 2326
4: 1544
1118483201_1118483202 -10 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC 0: 6
1: 1557
2: 4693
3: 2991
4: 1778
Right 1118483202 14:66188268-66188290 GTTGGGCTGCCTTGCTAGATTGG 0: 18
1: 3805
2: 2773
3: 2333
4: 1577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483201 Original CRISPR GCAGCCCAACATTCAGATTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr