ID: 1118483205

View in Genome Browser
Species Human (GRCh38)
Location 14:66188277-66188299
Sequence AGAACTTCCCCAATCTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8480
Summary {0: 3913, 1: 2579, 2: 1239, 3: 502, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483205_1118483211 13 Left 1118483205 14:66188277-66188299 CCTTGCTAGATTGGGGAAGTTCT 0: 3913
1: 2579
2: 1239
3: 502
4: 247
Right 1118483211 14:66188313-66188335 CTGCAGGGTGTTTTCCAACTTGG 0: 31
1: 4574
2: 2866
3: 1793
4: 1033
1118483205_1118483208 -2 Left 1118483205 14:66188277-66188299 CCTTGCTAGATTGGGGAAGTTCT 0: 3913
1: 2579
2: 1239
3: 502
4: 247
Right 1118483208 14:66188298-66188320 CTCCTGGATAATGTCCTGCAGGG No data
1118483205_1118483207 -3 Left 1118483205 14:66188277-66188299 CCTTGCTAGATTGGGGAAGTTCT 0: 3913
1: 2579
2: 1239
3: 502
4: 247
Right 1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483205 Original CRISPR AGAACTTCCCCAATCTAGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr